Incidental Mutation 'R7196:Ptch2'
ID559913
Institutional Source Beutler Lab
Gene Symbol Ptch2
Ensembl Gene ENSMUSG00000028681
Gene Namepatched 2
Synonymsptc2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7196 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location117096075-117116101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 117114749 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1156 (V1156G)
Ref Sequence ENSEMBL: ENSMUSP00000030443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030443] [ENSMUST00000144620]
Predicted Effect probably benign
Transcript: ENSMUST00000030443
AA Change: V1156G

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030443
Gene: ENSMUSG00000028681
AA Change: V1156G

DomainStartEndE-ValueType
low complexity region 58 77 N/A INTRINSIC
low complexity region 251 262 N/A INTRINSIC
Pfam:Patched 338 831 1.6e-42 PFAM
Pfam:Sterol-sensing 418 570 9.5e-49 PFAM
Pfam:Patched 901 1116 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144620
SMART Domains Protein: ENSMUSP00000122548
Gene: ENSMUSG00000028681

DomainStartEndE-ValueType
low complexity region 58 77 N/A INTRINSIC
low complexity region 251 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the patched family of transmembrane receptor proteins. The encoded protein may be a functional receptor for the morphogen sonic hedgehog (Shh) and is reportedly involved in limb and skin development. Homozygous mutant mice for this gene exhibit hair loss and epidermal hyperplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Male mice homozygous for a targeted gene disruption display anemia, abnormal red blood cells, enlarged spleens, extramedullary hematopoiesis, and an increased percentage of neutrophils. Most male mice homozygous for another allele display alopecia and skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
4921504E06Rik A C 2: 19,493,995 S396A probably benign Het
Actr6 C A 10: 89,714,922 V337F possibly damaging Het
Agtpbp1 T C 13: 59,533,180 T73A possibly damaging Het
AI182371 A T 2: 35,086,429 probably null Het
Apob A G 12: 7,983,893 E202G possibly damaging Het
Asb4 A T 6: 5,423,356 M168L probably benign Het
AU018091 T C 7: 3,163,958 Y152C probably damaging Het
Casp3 G A 8: 46,635,463 G132R possibly damaging Het
Cbfa2t3 C A 8: 122,638,990 A229S probably benign Het
Cdh23 A T 10: 60,307,980 Y2949N probably damaging Het
Ceacam3 T C 7: 17,154,956 Y217H Het
Cldn5 A T 16: 18,776,880 probably benign Het
Cltc T C 11: 86,706,831 D1093G probably damaging Het
Col4a2 A G 8: 11,398,693 Y71C probably damaging Het
Csf1 T C 3: 107,753,898 D77G possibly damaging Het
Cyp2j7 T A 4: 96,215,414 T295S probably benign Het
Dnah7a A T 1: 53,684,841 M133K probably benign Het
Dock5 G A 14: 67,756,470 P1852L probably damaging Het
Dpysl3 T A 18: 43,329,845 D489V probably damaging Het
Dsg4 T C 18: 20,466,480 Y718H probably damaging Het
Dync2h1 G A 9: 7,147,715 Q972* probably null Het
Epn1 G A 7: 5,093,381 D225N possibly damaging Het
Esp4 A G 17: 40,602,365 E41G probably benign Het
Fam171a2 T C 11: 102,438,346 D529G probably benign Het
Fbxl13 A T 5: 21,486,303 I694N probably damaging Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Galnt3 A G 2: 66,090,924 Y533H probably damaging Het
Gja5 C A 3: 97,051,106 R160S probably damaging Het
Gm12353 A T 4: 19,608,938 D7V unknown Het
Gm17669 T C 18: 67,562,502 F39S probably damaging Het
Gm7145 T A 1: 117,986,061 N224K possibly damaging Het
Gpd1 G T 15: 99,722,055 G245C probably benign Het
Gpr4 G A 7: 19,223,164 G337D probably benign Het
Hgd G A 16: 37,588,716 C14Y probably benign Het
Ibtk A T 9: 85,743,656 S14T probably damaging Het
Ifi205 G T 1: 174,026,543 N181K probably damaging Het
Inppl1 G A 7: 101,828,786 A673V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Jrkl G T 9: 13,244,157 P500T probably benign Het
Kcnq1 G A 7: 143,358,741 V515I possibly damaging Het
Kifc3 A G 8: 95,106,611 V453A probably benign Het
Krt10 C T 11: 99,387,545 E263K probably damaging Het
Lingo1 A T 9: 56,620,619 F235I probably damaging Het
Lmo7 T A 14: 101,896,500 D660E possibly damaging Het
Magi3 A C 3: 104,049,168 C661W probably benign Het
Mmp1a C T 9: 7,476,017 Q428* probably null Het
Msrb1 A T 17: 24,739,582 T47S probably benign Het
Naip6 A T 13: 100,300,158 I619K probably benign Het
Ndfip2 T C 14: 105,298,038 S253P probably damaging Het
Nebl A T 2: 17,452,518 V77E probably damaging Het
Nit1 T C 1: 171,344,435 E65G probably benign Het
Ntn4 C T 10: 93,733,714 H430Y probably benign Het
Nxpe5 A T 5: 138,239,324 I49F probably benign Het
Olfr1299 T G 2: 111,664,697 L157W probably damaging Het
Olfr18 A G 9: 20,314,198 Y241H probably benign Het
Olfr24 A T 9: 18,755,590 L15* probably null Het
Olfr310 A T 7: 86,269,441 M116K probably damaging Het
Olfr382 A G 11: 73,517,131 Y23H probably benign Het
Olfr605 A T 7: 103,442,997 M42K probably benign Het
Olfr714 A G 7: 107,074,728 N300S probably benign Het
Olfr95 A G 17: 37,211,193 I220T probably damaging Het
Oxct2a T A 4: 123,323,372 N72I probably damaging Het
Plekha5 G T 6: 140,543,922 V236L possibly damaging Het
Prdm1 A G 10: 44,456,992 S44P probably benign Het
Prss46 T A 9: 110,851,465 L226Q probably benign Het
Prss47 C A 13: 65,044,826 W380C probably benign Het
Rab3gap2 T C 1: 185,281,667 F1190S probably damaging Het
Raver2 T G 4: 101,102,859 Y179D probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Ripor2 T G 13: 24,704,825 I629S possibly damaging Het
Robo4 T A 9: 37,402,705 M84K possibly damaging Het
Rps6ka5 A T 12: 100,595,864 S252T possibly damaging Het
Rtl1 C T 12: 109,592,787 V873M possibly damaging Het
Sla T A 15: 66,831,571 R4W probably benign Het
Smco1 A G 16: 32,273,802 D97G probably damaging Het
Srgap1 T C 10: 121,840,848 T414A probably benign Het
Syt14 A G 1: 193,035,628 I3T probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tnpo2 G A 8: 85,047,137 V303M possibly damaging Het
Tstd2 A C 4: 46,119,955 S332R probably damaging Het
Ttn C A 2: 76,752,042 A22836S possibly damaging Het
Ufl1 A G 4: 25,250,669 V728A probably benign Het
Usp33 A T 3: 152,384,191 K789N possibly damaging Het
Usp54 T A 14: 20,588,370 Q214L probably damaging Het
Vmn2r7 T G 3: 64,715,777 N374T probably benign Het
Zbtb7a T A 10: 81,144,600 N209K probably damaging Het
Zc3hav1 A G 6: 38,329,272 V615A probably benign Het
Zdhhc20 A G 14: 57,873,891 probably null Het
Zfp90 G T 8: 106,425,148 V498L probably damaging Het
Other mutations in Ptch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Ptch2 APN 4 117114082 missense probably damaging 1.00
IGL01684:Ptch2 APN 4 117104787 missense probably damaging 1.00
IGL01967:Ptch2 APN 4 117114233 splice site probably benign
IGL02449:Ptch2 APN 4 117108183 missense possibly damaging 0.79
IGL02488:Ptch2 APN 4 117110396 missense probably damaging 0.99
IGL02935:Ptch2 APN 4 117114770 missense probably damaging 1.00
R0103:Ptch2 UTSW 4 117109425 splice site probably benign
R0326:Ptch2 UTSW 4 117108884 missense probably damaging 1.00
R0403:Ptch2 UTSW 4 117110839 nonsense probably null
R0499:Ptch2 UTSW 4 117111143 nonsense probably null
R0550:Ptch2 UTSW 4 117096433 splice site probably benign
R0565:Ptch2 UTSW 4 117106143 splice site probably benign
R1469:Ptch2 UTSW 4 117108465 missense probably benign
R1469:Ptch2 UTSW 4 117108465 missense probably benign
R1484:Ptch2 UTSW 4 117110849 missense probably damaging 0.97
R1920:Ptch2 UTSW 4 117108661 missense probably benign 0.09
R4080:Ptch2 UTSW 4 117111206 missense probably damaging 1.00
R4611:Ptch2 UTSW 4 117110378 missense probably benign 0.24
R5117:Ptch2 UTSW 4 117105949 missense probably damaging 1.00
R5240:Ptch2 UTSW 4 117106138 splice site probably benign
R5936:Ptch2 UTSW 4 117108294 missense probably benign 0.39
R5987:Ptch2 UTSW 4 117110057 missense probably benign 0.13
R6155:Ptch2 UTSW 4 117096908 missense probably damaging 1.00
R7158:Ptch2 UTSW 4 117114784 missense possibly damaging 0.76
X0019:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0024:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0025:Ptch2 UTSW 4 117096986 missense probably damaging 1.00
X0035:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0038:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0039:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0040:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0052:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0053:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0054:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0061:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GTGGGACTGGCCTTACTTAG -3'
(R):5'- GGTCTCTGTGGTTCTGACAC -3'

Sequencing Primer
(F):5'- ACTTAGCCTTTTAGGACCCAGGG -3'
(R):5'- GACACTCTTTCACTCGGTGGCTAG -3'
Posted On2019-06-26