Incidental Mutation 'R7197:Padi4'
ID560001
Institutional Source Beutler Lab
Gene Symbol Padi4
Ensembl Gene ENSMUSG00000025330
Gene Namepeptidyl arginine deiminase, type IV
SynonymsPAD type IV, Pdi4, Pad4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7197 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location140745865-140774236 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 140761658 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 157 (E157*)
Ref Sequence ENSEMBL: ENSMUSP00000026381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026381]
Predicted Effect probably null
Transcript: ENSMUST00000026381
AA Change: E157*
SMART Domains Protein: ENSMUSP00000026381
Gene: ENSMUSG00000025330
AA Change: E157*

DomainStartEndE-ValueType
Pfam:PAD_N 1 111 2.3e-38 PFAM
Pfam:PAD_M 113 273 2.4e-63 PFAM
Pfam:PAD 283 663 2.4e-176 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a gene family which encodes enzymes responsible for the conversion of arginine residues to citrulline residues. This gene may play a role in granulocyte and macrophage development leading to inflammation and immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice are viable albeit reduced number than expected were born from heterozygous crosses, and shows decreased antibacterial immune responses. Mice homozygous for a different knock-out allele exhibit decreased weight loss in response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
Aars2 T C 17: 45,508,959 Y221H probably damaging Het
Abca8b G A 11: 109,945,822 R1216* probably null Het
Acer2 A G 4: 86,887,050 T84A probably null Het
Adgrb2 A G 4: 130,009,522 N613S probably damaging Het
Arap2 T C 5: 62,641,386 D1300G possibly damaging Het
Ccl11 A T 11: 82,057,839 probably benign Het
Cfh A T 1: 140,088,767 Y1151* probably null Het
Cobll1 A G 2: 65,098,538 S815P probably benign Het
Cryz T C 3: 154,621,568 S240P probably damaging Het
Csmd2 A G 4: 128,511,033 Y2404C Het
F13a1 T C 13: 36,916,886 D428G probably damaging Het
Fbxo42 A G 4: 141,200,085 S559G probably benign Het
Fry A G 5: 150,469,767 S263G Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Gatsl3 T C 11: 4,218,949 C39R probably damaging Het
Gm1527 A G 3: 28,926,541 M597V probably null Het
Gpr158 A T 2: 21,810,601 T602S probably damaging Het
Hmgxb4 C A 8: 75,029,996 T583K probably damaging Het
Igkv8-30 C T 6: 70,117,085 C114Y probably damaging Het
Igsf5 T A 16: 96,403,346 N366K probably damaging Het
Kif15 T C 9: 123,009,926 probably null Het
Klk1b26 T A 7: 44,016,397 probably null Het
Lama1 G T 17: 67,737,705 E200* probably null Het
Lpar5 C T 6: 125,082,384 T356I probably benign Het
Lrch3 A T 16: 32,990,295 T538S probably damaging Het
Mansc4 A G 6: 147,075,705 S138P probably damaging Het
Mief1 T C 15: 80,249,860 S373P possibly damaging Het
Nbas G T 12: 13,520,750 V2053F possibly damaging Het
Nek11 T C 9: 105,244,415 E435G probably damaging Het
Nynrin A T 14: 55,871,923 I1496F probably benign Het
Odf1 A T 15: 38,219,550 M41L probably benign Het
Olfr1209 A T 2: 88,910,364 F10I probably benign Het
Olfr1220 A G 2: 89,097,282 V215A probably benign Het
Olfr713 A G 7: 107,036,157 M8V probably benign Het
Olfr871 T G 9: 20,212,555 S69A probably benign Het
Oxnad1 T C 14: 32,096,516 V106A possibly damaging Het
Parp10 A T 15: 76,242,416 F217L probably damaging Het
Pcdhb18 T A 18: 37,490,383 S255R probably benign Het
Pde4c G T 8: 70,745,329 G102W probably damaging Het
Pde6a T C 18: 61,258,224 Y547H probably damaging Het
Phf11b A T 14: 59,326,058 L137I probably benign Het
Pigh A C 12: 79,083,689 I134S probably damaging Het
Pigt G A 2: 164,502,516 V362M probably damaging Het
Pld1 A G 3: 28,024,252 D20G probably damaging Het
Pou3f2 T C 4: 22,487,288 R282G probably damaging Het
Ppp2r5d A G 17: 46,685,601 V382A probably damaging Het
Prdm16 T C 4: 154,341,510 E606G probably damaging Het
Psg28 A G 7: 18,430,584 Y68H probably damaging Het
Qpctl C A 7: 19,149,019 W56L probably damaging Het
Rab11fip5 G A 6: 85,342,155 P584L probably damaging Het
Sde2 C T 1: 180,851,278 H36Y probably benign Het
Sema4d T C 13: 51,702,836 S787G probably benign Het
Shroom3 A G 5: 92,942,604 E1071G probably damaging Het
Skint5 A G 4: 113,580,482 probably null Het
Slc44a3 T A 3: 121,525,762 D110V probably benign Het
Slc4a4 A C 5: 88,934,574 probably benign Het
Slc4a8 A G 15: 100,790,976 D389G probably damaging Het
Sp3 C G 2: 72,979,609 E11Q probably benign Het
Srrm2 A G 17: 23,818,224 S1281G unknown Het
Tat A T 8: 109,996,827 I316F probably benign Het
Thoc5 A G 11: 4,915,563 T381A probably benign Het
Tiam1 T C 16: 89,884,938 Y384C probably damaging Het
Tmem45a A T 16: 56,811,663 F197L probably damaging Het
Trav8d-1 A G 14: 52,778,978 Y107C probably damaging Het
Trim10 T A 17: 36,876,954 V354D probably damaging Het
Unc45b A T 11: 82,940,187 probably null Het
Unc79 A G 12: 103,112,506 I1643M probably benign Het
Unc80 G T 1: 66,521,566 G818* probably null Het
Usp15 A T 10: 123,131,005 M470K possibly damaging Het
Vldlr T C 19: 27,234,841 V85A probably benign Het
Vma21-ps A G 4: 52,496,994 V84A probably benign Het
Vmn2r67 C T 7: 85,136,566 V744I possibly damaging Het
Wdr73 A G 7: 80,893,198 C221R probably benign Het
Zxdc C T 6: 90,378,837 H443Y probably damaging Het
Other mutations in Padi4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02439:Padi4 APN 4 140746221 missense probably damaging 1.00
R0411:Padi4 UTSW 4 140748449 critical splice donor site probably benign
R0528:Padi4 UTSW 4 140769429 missense possibly damaging 0.75
R0544:Padi4 UTSW 4 140748449 critical splice donor site probably benign
R0547:Padi4 UTSW 4 140748449 critical splice donor site probably benign
R0548:Padi4 UTSW 4 140748449 critical splice donor site probably benign
R0633:Padi4 UTSW 4 140757585 missense probably damaging 1.00
R1112:Padi4 UTSW 4 140758116 missense probably benign 0.04
R1411:Padi4 UTSW 4 140752603 missense probably damaging 1.00
R1573:Padi4 UTSW 4 140757570 missense possibly damaging 0.86
R1741:Padi4 UTSW 4 140746170 missense probably damaging 1.00
R2256:Padi4 UTSW 4 140759940 missense possibly damaging 0.77
R2257:Padi4 UTSW 4 140759940 missense possibly damaging 0.77
R5257:Padi4 UTSW 4 140746204 missense probably benign 0.01
R5266:Padi4 UTSW 4 140746131 missense possibly damaging 0.86
R6044:Padi4 UTSW 4 140748127 missense possibly damaging 0.94
R6057:Padi4 UTSW 4 140760040 missense probably damaging 0.99
R6180:Padi4 UTSW 4 140756473 missense possibly damaging 0.87
R7395:Padi4 UTSW 4 140761672 missense probably damaging 1.00
X0028:Padi4 UTSW 4 140746124 makesense probably null
Predicted Primers PCR Primer
(F):5'- GGTAGGTCACTTGCTTCTCC -3'
(R):5'- ACTCTTTGGGCCAGGAATTG -3'

Sequencing Primer
(F):5'- CACTCCGTCCTCTATAATGTGC -3'
(R):5'- AATTGCTGGGTAAGTAAAAGCC -3'
Posted On2019-06-26