Incidental Mutation 'R7197:Rab11fip5'
ID560009
Institutional Source Beutler Lab
Gene Symbol Rab11fip5
Ensembl Gene ENSMUSG00000051343
Gene NameRAB11 family interacting protein 5 (class I)
SynonymsRIP11, D6Ertd32e, GAF1, 9130206P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7197 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location85334962-85374634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85342155 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 584 (P584L)
Ref Sequence ENSEMBL: ENSMUSP00000145402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060837] [ENSMUST00000204087]
Predicted Effect probably benign
Transcript: ENSMUST00000060837
SMART Domains Protein: ENSMUSP00000058305
Gene: ENSMUSG00000051343

DomainStartEndE-ValueType
C2 20 143 8.7e-7 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
Pfam:RBD-FIP 593 640 5.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204087
AA Change: P584L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145402
Gene: ENSMUSG00000051343
AA Change: P584L

DomainStartEndE-ValueType
C2 20 143 5.8e-9 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
low complexity region 529 547 N/A INTRINSIC
low complexity region 560 568 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 687 692 N/A INTRINSIC
low complexity region 713 732 N/A INTRINSIC
low complexity region 852 887 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 1037 1052 N/A INTRINSIC
low complexity region 1068 1106 N/A INTRINSIC
low complexity region 1115 1149 N/A INTRINSIC
Pfam:RBD-FIP 1266 1313 8.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
Aars2 T C 17: 45,508,959 Y221H probably damaging Het
Abca8b G A 11: 109,945,822 R1216* probably null Het
Acad8 A T 9: 26,977,671 probably null Het
Acer2 A G 4: 86,887,050 T84A probably null Het
Adgrb2 A G 4: 130,009,522 N613S probably damaging Het
Arap2 T C 5: 62,641,386 D1300G possibly damaging Het
Ccl11 A T 11: 82,057,839 probably benign Het
Cfh A T 1: 140,088,767 Y1151* probably null Het
Cobll1 A G 2: 65,098,538 S815P probably benign Het
Cryz T C 3: 154,621,568 S240P probably damaging Het
Csmd2 A G 4: 128,511,033 Y2404C Het
F13a1 T C 13: 36,916,886 D428G probably damaging Het
Fbxo42 A G 4: 141,200,085 S559G probably benign Het
Fry A G 5: 150,469,767 S263G Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Gatsl3 T C 11: 4,218,949 C39R probably damaging Het
Gm1527 A G 3: 28,926,541 M597V probably null Het
Gpr158 A T 2: 21,810,601 T602S probably damaging Het
Hmgxb4 C A 8: 75,029,996 T583K probably damaging Het
Igkv8-30 C T 6: 70,117,085 C114Y probably damaging Het
Igsf5 T A 16: 96,403,346 N366K probably damaging Het
Kif15 T C 9: 123,009,926 probably null Het
Klk1b26 T A 7: 44,016,397 probably null Het
Lama1 G T 17: 67,737,705 E200* probably null Het
Lpar5 C T 6: 125,082,384 T356I probably benign Het
Lrch3 A T 16: 32,990,295 T538S probably damaging Het
Mansc4 A G 6: 147,075,705 S138P probably damaging Het
Mief1 T C 15: 80,249,860 S373P possibly damaging Het
Nbas G T 12: 13,520,750 V2053F possibly damaging Het
Nek11 T C 9: 105,244,415 E435G probably damaging Het
Nynrin A T 14: 55,871,923 I1496F probably benign Het
Odf1 A T 15: 38,219,550 M41L probably benign Het
Olfr1209 A T 2: 88,910,364 F10I probably benign Het
Olfr1220 A G 2: 89,097,282 V215A probably benign Het
Olfr713 A G 7: 107,036,157 M8V probably benign Het
Olfr871 T G 9: 20,212,555 S69A probably benign Het
Oxnad1 T C 14: 32,096,516 V106A possibly damaging Het
Padi4 C A 4: 140,761,658 E157* probably null Het
Parp10 A T 15: 76,242,416 F217L probably damaging Het
Pcdhb18 T A 18: 37,490,383 S255R probably benign Het
Pde4c G T 8: 70,745,329 G102W probably damaging Het
Pde6a T C 18: 61,258,224 Y547H probably damaging Het
Phf11b A T 14: 59,326,058 L137I probably benign Het
Pigh A C 12: 79,083,689 I134S probably damaging Het
Pigt G A 2: 164,502,516 V362M probably damaging Het
Pld1 A G 3: 28,024,252 D20G probably damaging Het
Pou3f2 T C 4: 22,487,288 R282G probably damaging Het
Ppp2r5d A G 17: 46,685,601 V382A probably damaging Het
Prdm16 T C 4: 154,341,510 E606G probably damaging Het
Psg28 A G 7: 18,430,584 Y68H probably damaging Het
Qpctl C A 7: 19,149,019 W56L probably damaging Het
Sde2 C T 1: 180,851,278 H36Y probably benign Het
Sema4d T C 13: 51,702,836 S787G probably benign Het
Sgca C T 11: 94,973,188 probably null Het
Shroom3 A G 5: 92,942,604 E1071G probably damaging Het
Skint5 A G 4: 113,580,482 probably null Het
Slc44a3 T A 3: 121,525,762 D110V probably benign Het
Slc4a4 A C 5: 88,934,574 probably benign Het
Slc4a8 A G 15: 100,790,976 D389G probably damaging Het
Sp3 C G 2: 72,979,609 E11Q probably benign Het
Srrm2 A G 17: 23,818,224 S1281G unknown Het
Tat A T 8: 109,996,827 I316F probably benign Het
Thoc5 A G 11: 4,915,563 T381A probably benign Het
Tiam1 T C 16: 89,884,938 Y384C probably damaging Het
Tmem45a A T 16: 56,811,663 F197L probably damaging Het
Trav8d-1 A G 14: 52,778,978 Y107C probably damaging Het
Trim10 T A 17: 36,876,954 V354D probably damaging Het
Unc45b A T 11: 82,940,187 probably null Het
Unc79 A G 12: 103,112,506 I1643M probably benign Het
Unc80 G T 1: 66,521,566 G818* probably null Het
Usp15 A T 10: 123,131,005 M470K possibly damaging Het
Vldlr T C 19: 27,234,841 V85A probably benign Het
Vma21-ps A G 4: 52,496,994 V84A probably benign Het
Vmn2r67 C T 7: 85,136,566 V744I possibly damaging Het
Wdr73 A G 7: 80,893,198 C221R probably benign Het
Zxdc C T 6: 90,378,837 H443Y probably damaging Het
Other mutations in Rab11fip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Rab11fip5 APN 6 85337552 missense probably damaging 1.00
IGL02471:Rab11fip5 APN 6 85348225 missense probably damaging 0.99
IGL02725:Rab11fip5 APN 6 85374489 missense probably damaging 0.99
IGL02737:Rab11fip5 APN 6 85348558 missense probably damaging 1.00
PIT4812001:Rab11fip5 UTSW 6 85341558 missense probably benign 0.38
R0627:Rab11fip5 UTSW 6 85348051 missense probably benign 0.05
R1652:Rab11fip5 UTSW 6 85348297 missense probably damaging 0.97
R1961:Rab11fip5 UTSW 6 85348991 missense possibly damaging 0.87
R2106:Rab11fip5 UTSW 6 85374387 missense probably damaging 0.98
R2142:Rab11fip5 UTSW 6 85337228 critical splice acceptor site probably null
R4729:Rab11fip5 UTSW 6 85374267 missense probably damaging 0.99
R5001:Rab11fip5 UTSW 6 85347806 missense probably damaging 1.00
R5116:Rab11fip5 UTSW 6 85348807 missense probably damaging 1.00
R5506:Rab11fip5 UTSW 6 85374137 missense probably damaging 1.00
R5801:Rab11fip5 UTSW 6 85337600 missense probably damaging 0.99
R6338:Rab11fip5 UTSW 6 85341378 missense possibly damaging 0.94
R6696:Rab11fip5 UTSW 6 85341946 missense possibly damaging 0.65
R6763:Rab11fip5 UTSW 6 85342170 missense probably benign 0.02
R6880:Rab11fip5 UTSW 6 85348845 missense probably damaging 0.99
R6932:Rab11fip5 UTSW 6 85341558 missense probably benign 0.38
R7042:Rab11fip5 UTSW 6 85374128 missense possibly damaging 0.82
R7112:Rab11fip5 UTSW 6 85348194 missense probably damaging 1.00
R7384:Rab11fip5 UTSW 6 85348330 missense possibly damaging 0.47
R7395:Rab11fip5 UTSW 6 85341868 missense probably benign
R7451:Rab11fip5 UTSW 6 85341556 missense probably benign 0.06
R7482:Rab11fip5 UTSW 6 85340778 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ATGTTGAAGGTGTCGTCCCAC -3'
(R):5'- CCAGGAGGCTCATGGTTTTG -3'

Sequencing Primer
(F):5'- AAGGTGTCGTCCCACTCAGG -3'
(R):5'- GACGTGTCTCCTCAGGTAGAATC -3'
Posted On2019-06-26