Incidental Mutation 'R7197:Kif15'
ID560025
Institutional Source Beutler Lab
Gene Symbol Kif15
Ensembl Gene ENSMUSG00000036768
Gene Namekinesin family member 15
SynonymsHKLP2, Knsl7, N-10 kinesin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7197 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location122951046-123018733 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 123009926 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040717] [ENSMUST00000216048] [ENSMUST00000216062]
Predicted Effect probably null
Transcript: ENSMUST00000040717
SMART Domains Protein: ENSMUSP00000035490
Gene: ENSMUSG00000036768

DomainStartEndE-ValueType
KISc 24 371 2.86e-179 SMART
Pfam:Kinesin-relat_1 463 551 6.6e-26 PFAM
coiled coil region 579 643 N/A INTRINSIC
coiled coil region 706 1037 N/A INTRINSIC
coiled coil region 1065 1133 N/A INTRINSIC
Pfam:HMMR_C 1265 1387 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214311
Predicted Effect probably benign
Transcript: ENSMUST00000216048
Predicted Effect probably benign
Transcript: ENSMUST00000216062
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
Aars2 T C 17: 45,508,959 Y221H probably damaging Het
Abca8b G A 11: 109,945,822 R1216* probably null Het
Acer2 A G 4: 86,887,050 T84A probably null Het
Adgrb2 A G 4: 130,009,522 N613S probably damaging Het
Arap2 T C 5: 62,641,386 D1300G possibly damaging Het
Ccl11 A T 11: 82,057,839 probably benign Het
Cfh A T 1: 140,088,767 Y1151* probably null Het
Cobll1 A G 2: 65,098,538 S815P probably benign Het
Cryz T C 3: 154,621,568 S240P probably damaging Het
Csmd2 A G 4: 128,511,033 Y2404C Het
F13a1 T C 13: 36,916,886 D428G probably damaging Het
Fbxo42 A G 4: 141,200,085 S559G probably benign Het
Fry A G 5: 150,469,767 S263G Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Gatsl3 T C 11: 4,218,949 C39R probably damaging Het
Gm1527 A G 3: 28,926,541 M597V probably null Het
Gpr158 A T 2: 21,810,601 T602S probably damaging Het
Hmgxb4 C A 8: 75,029,996 T583K probably damaging Het
Igkv8-30 C T 6: 70,117,085 C114Y probably damaging Het
Igsf5 T A 16: 96,403,346 N366K probably damaging Het
Klk1b26 T A 7: 44,016,397 probably null Het
Lama1 G T 17: 67,737,705 E200* probably null Het
Lpar5 C T 6: 125,082,384 T356I probably benign Het
Lrch3 A T 16: 32,990,295 T538S probably damaging Het
Mansc4 A G 6: 147,075,705 S138P probably damaging Het
Mief1 T C 15: 80,249,860 S373P possibly damaging Het
Nbas G T 12: 13,520,750 V2053F possibly damaging Het
Nek11 T C 9: 105,244,415 E435G probably damaging Het
Nynrin A T 14: 55,871,923 I1496F probably benign Het
Odf1 A T 15: 38,219,550 M41L probably benign Het
Olfr1209 A T 2: 88,910,364 F10I probably benign Het
Olfr1220 A G 2: 89,097,282 V215A probably benign Het
Olfr713 A G 7: 107,036,157 M8V probably benign Het
Olfr871 T G 9: 20,212,555 S69A probably benign Het
Oxnad1 T C 14: 32,096,516 V106A possibly damaging Het
Padi4 C A 4: 140,761,658 E157* probably null Het
Parp10 A T 15: 76,242,416 F217L probably damaging Het
Pcdhb18 T A 18: 37,490,383 S255R probably benign Het
Pde4c G T 8: 70,745,329 G102W probably damaging Het
Pde6a T C 18: 61,258,224 Y547H probably damaging Het
Phf11b A T 14: 59,326,058 L137I probably benign Het
Pigh A C 12: 79,083,689 I134S probably damaging Het
Pigt G A 2: 164,502,516 V362M probably damaging Het
Pld1 A G 3: 28,024,252 D20G probably damaging Het
Pou3f2 T C 4: 22,487,288 R282G probably damaging Het
Ppp2r5d A G 17: 46,685,601 V382A probably damaging Het
Prdm16 T C 4: 154,341,510 E606G probably damaging Het
Psg28 A G 7: 18,430,584 Y68H probably damaging Het
Qpctl C A 7: 19,149,019 W56L probably damaging Het
Rab11fip5 G A 6: 85,342,155 P584L probably damaging Het
Sde2 C T 1: 180,851,278 H36Y probably benign Het
Sema4d T C 13: 51,702,836 S787G probably benign Het
Shroom3 A G 5: 92,942,604 E1071G probably damaging Het
Skint5 A G 4: 113,580,482 probably null Het
Slc44a3 T A 3: 121,525,762 D110V probably benign Het
Slc4a4 A C 5: 88,934,574 probably benign Het
Slc4a8 A G 15: 100,790,976 D389G probably damaging Het
Sp3 C G 2: 72,979,609 E11Q probably benign Het
Srrm2 A G 17: 23,818,224 S1281G unknown Het
Tat A T 8: 109,996,827 I316F probably benign Het
Thoc5 A G 11: 4,915,563 T381A probably benign Het
Tiam1 T C 16: 89,884,938 Y384C probably damaging Het
Tmem45a A T 16: 56,811,663 F197L probably damaging Het
Trav8d-1 A G 14: 52,778,978 Y107C probably damaging Het
Trim10 T A 17: 36,876,954 V354D probably damaging Het
Unc45b A T 11: 82,940,187 probably null Het
Unc79 A G 12: 103,112,506 I1643M probably benign Het
Unc80 G T 1: 66,521,566 G818* probably null Het
Usp15 A T 10: 123,131,005 M470K possibly damaging Het
Vldlr T C 19: 27,234,841 V85A probably benign Het
Vma21-ps A G 4: 52,496,994 V84A probably benign Het
Vmn2r67 C T 7: 85,136,566 V744I possibly damaging Het
Wdr73 A G 7: 80,893,198 C221R probably benign Het
Zxdc C T 6: 90,378,837 H443Y probably damaging Het
Other mutations in Kif15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Kif15 APN 9 122975755 missense probably damaging 1.00
IGL01577:Kif15 APN 9 122996334 missense probably benign 0.06
IGL01647:Kif15 APN 9 122963471 intron probably benign
IGL01921:Kif15 APN 9 122979504 missense probably damaging 1.00
IGL02040:Kif15 APN 9 123017385 missense probably damaging 0.99
IGL02191:Kif15 APN 9 122975679 missense probably damaging 1.00
IGL02218:Kif15 APN 9 122995827 splice site probably benign
IGL02537:Kif15 APN 9 122993849 missense probably benign 0.08
IGL02814:Kif15 APN 9 123003640 missense possibly damaging 0.83
PIT4480001:Kif15 UTSW 9 123011543 missense probably benign
R0034:Kif15 UTSW 9 122999285 missense possibly damaging 0.47
R0458:Kif15 UTSW 9 123009359 missense probably benign
R0526:Kif15 UTSW 9 122997797 missense probably damaging 0.96
R0533:Kif15 UTSW 9 123009433 unclassified probably benign
R0726:Kif15 UTSW 9 122959928 missense probably benign 0.21
R1580:Kif15 UTSW 9 122959956 missense probably benign 0.22
R1597:Kif15 UTSW 9 122994009 missense probably benign 0.22
R2096:Kif15 UTSW 9 122986187 missense probably damaging 1.00
R3125:Kif15 UTSW 9 122987961 missense probably damaging 0.99
R3176:Kif15 UTSW 9 122987840 splice site probably benign
R4088:Kif15 UTSW 9 122986189 missense probably benign 0.29
R4308:Kif15 UTSW 9 123013982 missense probably benign 0.00
R4597:Kif15 UTSW 9 122993849 missense probably benign 0.08
R4705:Kif15 UTSW 9 122959993 splice site probably null
R4832:Kif15 UTSW 9 123002126 splice site probably null
R5100:Kif15 UTSW 9 122991994 missense probably damaging 0.98
R5126:Kif15 UTSW 9 122975758 missense probably damaging 1.00
R5180:Kif15 UTSW 9 122999210 missense probably damaging 0.99
R5247:Kif15 UTSW 9 122986442 missense possibly damaging 0.65
R5376:Kif15 UTSW 9 122993971 missense probably benign 0.04
R5392:Kif15 UTSW 9 122996295 missense probably damaging 0.99
R5422:Kif15 UTSW 9 122984889 synonymous probably null
R5562:Kif15 UTSW 9 122978016 missense probably damaging 1.00
R5663:Kif15 UTSW 9 122991851 splice site probably null
R5767:Kif15 UTSW 9 123013974 missense possibly damaging 0.78
R5927:Kif15 UTSW 9 123017261 missense probably benign 0.00
R6049:Kif15 UTSW 9 123011622 missense probably damaging 0.98
R6435:Kif15 UTSW 9 122986491 missense probably damaging 1.00
R7040:Kif15 UTSW 9 123011614 missense possibly damaging 0.67
R7158:Kif15 UTSW 9 122999314 missense probably benign
R7163:Kif15 UTSW 9 123017657 missense probably damaging 1.00
R7318:Kif15 UTSW 9 122987949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTGGTTTTATTTCAGAGTCCC -3'
(R):5'- AACCTCCTGCACAAGTCAGG -3'

Sequencing Primer
(F):5'- GTTTTATTTCAGAGTCCCAAAACACC -3'
(R):5'- GGGAGGAAGACTTCTCTATC -3'
Posted On2019-06-26