Incidental Mutation 'R7197:Srrm2'
ID560049
Institutional Source Beutler Lab
Gene Symbol Srrm2
Ensembl Gene ENSMUSG00000039218
Gene Nameserine/arginine repetitive matrix 2
Synonyms5033413A03Rik, SRm300
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R7197 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23790662-23824741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23818224 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1281 (S1281G)
Ref Sequence ENSEMBL: ENSMUSP00000085993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088621] [ENSMUST00000190686]
Predicted Effect unknown
Transcript: ENSMUST00000088621
AA Change: S1281G
SMART Domains Protein: ENSMUSP00000085993
Gene: ENSMUSG00000039218
AA Change: S1281G

DomainStartEndE-ValueType
low complexity region 82 157 N/A INTRINSIC
low complexity region 161 188 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
internal_repeat_4 248 305 2.93e-5 PROSPERO
internal_repeat_5 259 388 2.93e-5 PROSPERO
low complexity region 407 423 N/A INTRINSIC
CTD 464 584 5.25e-14 SMART
low complexity region 652 682 N/A INTRINSIC
low complexity region 689 721 N/A INTRINSIC
internal_repeat_6 732 778 4.88e-5 PROSPERO
low complexity region 779 795 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
internal_repeat_2 859 1124 6.34e-6 PROSPERO
internal_repeat_1 1055 1183 3.81e-6 PROSPERO
internal_repeat_4 1113 1166 2.93e-5 PROSPERO
internal_repeat_6 1169 1213 4.88e-5 PROSPERO
low complexity region 1236 1244 N/A INTRINSIC
low complexity region 1275 1286 N/A INTRINSIC
low complexity region 1290 1312 N/A INTRINSIC
internal_repeat_2 1313 1485 6.34e-6 PROSPERO
low complexity region 1493 1525 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
low complexity region 1559 1720 N/A INTRINSIC
low complexity region 1734 1919 N/A INTRINSIC
low complexity region 1926 1951 N/A INTRINSIC
low complexity region 1966 1980 N/A INTRINSIC
low complexity region 2079 2105 N/A INTRINSIC
internal_repeat_3 2107 2118 1.06e-5 PROSPERO
internal_repeat_3 2135 2146 1.06e-5 PROSPERO
low complexity region 2153 2172 N/A INTRINSIC
internal_repeat_5 2182 2320 2.93e-5 PROSPERO
internal_repeat_1 2224 2368 3.81e-6 PROSPERO
low complexity region 2390 2425 N/A INTRINSIC
low complexity region 2518 2539 N/A INTRINSIC
low complexity region 2541 2550 N/A INTRINSIC
low complexity region 2552 2571 N/A INTRINSIC
low complexity region 2594 2607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186259
Predicted Effect unknown
Transcript: ENSMUST00000190686
AA Change: S1377G
SMART Domains Protein: ENSMUSP00000139842
Gene: ENSMUSG00000039218
AA Change: S1377G

DomainStartEndE-ValueType
Pfam:cwf21 58 102 1.5e-13 PFAM
low complexity region 178 253 N/A INTRINSIC
low complexity region 257 284 N/A INTRINSIC
low complexity region 319 334 N/A INTRINSIC
internal_repeat_4 344 401 3.07e-5 PROSPERO
internal_repeat_5 355 484 3.07e-5 PROSPERO
low complexity region 503 519 N/A INTRINSIC
CTD 560 680 5.25e-14 SMART
low complexity region 748 778 N/A INTRINSIC
low complexity region 785 817 N/A INTRINSIC
internal_repeat_6 828 874 5.11e-5 PROSPERO
low complexity region 875 891 N/A INTRINSIC
low complexity region 898 920 N/A INTRINSIC
low complexity region 935 949 N/A INTRINSIC
internal_repeat_2 955 1220 6.62e-6 PROSPERO
internal_repeat_1 1151 1279 3.97e-6 PROSPERO
internal_repeat_4 1209 1262 3.07e-5 PROSPERO
internal_repeat_6 1265 1309 5.11e-5 PROSPERO
low complexity region 1332 1340 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
low complexity region 1386 1408 N/A INTRINSIC
internal_repeat_2 1409 1581 6.62e-6 PROSPERO
low complexity region 1589 1621 N/A INTRINSIC
low complexity region 1641 1651 N/A INTRINSIC
low complexity region 1655 1816 N/A INTRINSIC
low complexity region 1830 2015 N/A INTRINSIC
low complexity region 2022 2047 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
low complexity region 2175 2201 N/A INTRINSIC
internal_repeat_3 2203 2214 1.1e-5 PROSPERO
internal_repeat_3 2231 2242 1.1e-5 PROSPERO
low complexity region 2249 2268 N/A INTRINSIC
internal_repeat_5 2278 2416 3.07e-5 PROSPERO
internal_repeat_1 2320 2464 3.97e-6 PROSPERO
low complexity region 2486 2521 N/A INTRINSIC
low complexity region 2614 2635 N/A INTRINSIC
low complexity region 2637 2646 N/A INTRINSIC
low complexity region 2648 2667 N/A INTRINSIC
low complexity region 2690 2703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
Aars2 T C 17: 45,508,959 Y221H probably damaging Het
Abca8b G A 11: 109,945,822 R1216* probably null Het
Acer2 A G 4: 86,887,050 T84A probably null Het
Adgrb2 A G 4: 130,009,522 N613S probably damaging Het
Arap2 T C 5: 62,641,386 D1300G possibly damaging Het
Ccl11 A T 11: 82,057,839 probably benign Het
Cfh A T 1: 140,088,767 Y1151* probably null Het
Cobll1 A G 2: 65,098,538 S815P probably benign Het
Cryz T C 3: 154,621,568 S240P probably damaging Het
Csmd2 A G 4: 128,511,033 Y2404C Het
F13a1 T C 13: 36,916,886 D428G probably damaging Het
Fbxo42 A G 4: 141,200,085 S559G probably benign Het
Fry A G 5: 150,469,767 S263G Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Gatsl3 T C 11: 4,218,949 C39R probably damaging Het
Gm1527 A G 3: 28,926,541 M597V probably null Het
Gpr158 A T 2: 21,810,601 T602S probably damaging Het
Hmgxb4 C A 8: 75,029,996 T583K probably damaging Het
Igkv8-30 C T 6: 70,117,085 C114Y probably damaging Het
Igsf5 T A 16: 96,403,346 N366K probably damaging Het
Kif15 T C 9: 123,009,926 probably null Het
Klk1b26 T A 7: 44,016,397 probably null Het
Lama1 G T 17: 67,737,705 E200* probably null Het
Lpar5 C T 6: 125,082,384 T356I probably benign Het
Lrch3 A T 16: 32,990,295 T538S probably damaging Het
Mansc4 A G 6: 147,075,705 S138P probably damaging Het
Mief1 T C 15: 80,249,860 S373P possibly damaging Het
Nbas G T 12: 13,520,750 V2053F possibly damaging Het
Nek11 T C 9: 105,244,415 E435G probably damaging Het
Nynrin A T 14: 55,871,923 I1496F probably benign Het
Odf1 A T 15: 38,219,550 M41L probably benign Het
Olfr1209 A T 2: 88,910,364 F10I probably benign Het
Olfr1220 A G 2: 89,097,282 V215A probably benign Het
Olfr713 A G 7: 107,036,157 M8V probably benign Het
Olfr871 T G 9: 20,212,555 S69A probably benign Het
Oxnad1 T C 14: 32,096,516 V106A possibly damaging Het
Padi4 C A 4: 140,761,658 E157* probably null Het
Parp10 A T 15: 76,242,416 F217L probably damaging Het
Pcdhb18 T A 18: 37,490,383 S255R probably benign Het
Pde4c G T 8: 70,745,329 G102W probably damaging Het
Pde6a T C 18: 61,258,224 Y547H probably damaging Het
Phf11b A T 14: 59,326,058 L137I probably benign Het
Pigh A C 12: 79,083,689 I134S probably damaging Het
Pigt G A 2: 164,502,516 V362M probably damaging Het
Pld1 A G 3: 28,024,252 D20G probably damaging Het
Pou3f2 T C 4: 22,487,288 R282G probably damaging Het
Ppp2r5d A G 17: 46,685,601 V382A probably damaging Het
Prdm16 T C 4: 154,341,510 E606G probably damaging Het
Psg28 A G 7: 18,430,584 Y68H probably damaging Het
Qpctl C A 7: 19,149,019 W56L probably damaging Het
Rab11fip5 G A 6: 85,342,155 P584L probably damaging Het
Sde2 C T 1: 180,851,278 H36Y probably benign Het
Sema4d T C 13: 51,702,836 S787G probably benign Het
Shroom3 A G 5: 92,942,604 E1071G probably damaging Het
Skint5 A G 4: 113,580,482 probably null Het
Slc44a3 T A 3: 121,525,762 D110V probably benign Het
Slc4a4 A C 5: 88,934,574 probably benign Het
Slc4a8 A G 15: 100,790,976 D389G probably damaging Het
Sp3 C G 2: 72,979,609 E11Q probably benign Het
Tat A T 8: 109,996,827 I316F probably benign Het
Thoc5 A G 11: 4,915,563 T381A probably benign Het
Tiam1 T C 16: 89,884,938 Y384C probably damaging Het
Tmem45a A T 16: 56,811,663 F197L probably damaging Het
Trav8d-1 A G 14: 52,778,978 Y107C probably damaging Het
Trim10 T A 17: 36,876,954 V354D probably damaging Het
Unc45b A T 11: 82,940,187 probably null Het
Unc79 A G 12: 103,112,506 I1643M probably benign Het
Unc80 G T 1: 66,521,566 G818* probably null Het
Usp15 A T 10: 123,131,005 M470K possibly damaging Het
Vldlr T C 19: 27,234,841 V85A probably benign Het
Vma21-ps A G 4: 52,496,994 V84A probably benign Het
Vmn2r67 C T 7: 85,136,566 V744I possibly damaging Het
Wdr73 A G 7: 80,893,198 C221R probably benign Het
Zxdc C T 6: 90,378,837 H443Y probably damaging Het
Other mutations in Srrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Srrm2 APN 17 23812478 missense probably benign 0.23
IGL00484:Srrm2 APN 17 23818518 missense probably benign 0.23
IGL01413:Srrm2 APN 17 23816025 unclassified probably benign
IGL02272:Srrm2 APN 17 23815782 unclassified probably benign
IGL02279:Srrm2 APN 17 23815332 unclassified probably benign
IGL02325:Srrm2 APN 17 23810479 unclassified probably benign
IGL02947:Srrm2 APN 17 23810746 missense probably benign 0.23
IGL03002:Srrm2 APN 17 23815734 unclassified probably benign
R0173:Srrm2 UTSW 17 23815129 unclassified probably benign
R1018:Srrm2 UTSW 17 23822540 missense probably damaging 0.98
R1109:Srrm2 UTSW 17 23819617 unclassified probably benign
R1199:Srrm2 UTSW 17 23817751 unclassified probably benign
R1471:Srrm2 UTSW 17 23820796 missense probably damaging 1.00
R1478:Srrm2 UTSW 17 23815902 missense probably benign 0.23
R1618:Srrm2 UTSW 17 23818932 unclassified probably benign
R1678:Srrm2 UTSW 17 23818986 missense probably benign 0.23
R1853:Srrm2 UTSW 17 23820525 missense probably damaging 1.00
R1968:Srrm2 UTSW 17 23821491 missense probably damaging 1.00
R2094:Srrm2 UTSW 17 23812429 unclassified probably benign
R2102:Srrm2 UTSW 17 23817748 unclassified probably benign
R2156:Srrm2 UTSW 17 23818263 missense probably benign 0.23
R2214:Srrm2 UTSW 17 23816745 unclassified probably benign
R2913:Srrm2 UTSW 17 23815684 unclassified probably benign
R3721:Srrm2 UTSW 17 23822575 small deletion probably benign
R4411:Srrm2 UTSW 17 23810468 unclassified probably benign
R4412:Srrm2 UTSW 17 23810468 unclassified probably benign
R4413:Srrm2 UTSW 17 23810468 unclassified probably benign
R4583:Srrm2 UTSW 17 23819619 unclassified probably benign
R4682:Srrm2 UTSW 17 23815692 missense probably benign 0.23
R4910:Srrm2 UTSW 17 23815388 unclassified probably benign
R4943:Srrm2 UTSW 17 23822415 missense possibly damaging 0.94
R5023:Srrm2 UTSW 17 23819317 unclassified probably benign
R5033:Srrm2 UTSW 17 23820618 missense probably damaging 1.00
R5163:Srrm2 UTSW 17 23819550 unclassified probably benign
R5186:Srrm2 UTSW 17 23816587 missense probably benign 0.23
R5197:Srrm2 UTSW 17 23817384 missense probably benign 0.23
R5366:Srrm2 UTSW 17 23818704 missense probably benign 0.23
R5483:Srrm2 UTSW 17 23821272 missense probably damaging 0.96
R5551:Srrm2 UTSW 17 23818476 unclassified probably benign
R5602:Srrm2 UTSW 17 23819337 unclassified probably benign
R5733:Srrm2 UTSW 17 23821386 missense probably damaging 0.98
R5774:Srrm2 UTSW 17 23818275 unclassified probably benign
R5909:Srrm2 UTSW 17 23821317 missense probably benign 0.27
R5961:Srrm2 UTSW 17 23820109 unclassified probably benign
R6122:Srrm2 UTSW 17 23820356 missense possibly damaging 0.58
R6906:Srrm2 UTSW 17 23820363 missense probably damaging 0.97
R7084:Srrm2 UTSW 17 23820316 missense probably damaging 0.99
R7177:Srrm2 UTSW 17 23816773 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCTTTTCTCCTGAGGTTAAAGAAG -3'
(R):5'- ATTCACTTCGTCCCCTGGAG -3'

Sequencing Primer
(F):5'- GGATCATTCCTTAATCAAACAGAGGC -3'
(R):5'- AGGGGGTTTGAGGTGTATCTTTCATC -3'
Posted On2019-06-26