Incidental Mutation 'R7197:Vldlr'
ID560057
Institutional Source Beutler Lab
Gene Symbol Vldlr
Ensembl Gene ENSMUSG00000024924
Gene Namevery low density lipoprotein receptor
SynonymsAA408956, AI451093, AW047288, VLDL receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R7197 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location27216484-27254231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27234841 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 85 (V85A)
Ref Sequence ENSEMBL: ENSMUSP00000127329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000164746] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]
Predicted Effect probably benign
Transcript: ENSMUST00000025866
AA Change: V85A

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924
AA Change: V85A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
Blast:LY 461 495 4e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000047645
AA Change: V85A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: V85A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 1.25e-14 SMART
LDLa 112 149 7.15e-15 SMART
LDLa 151 190 1.23e-13 SMART
LDLa 197 234 1.1e-15 SMART
LDLa 236 273 1.13e-12 SMART
LDLa 276 316 3.86e-11 SMART
EGF_CA 315 354 1e-5 SMART
EGF_CA 355 394 6.1e-10 SMART
LY 420 462 2.16e-1 SMART
LY 464 506 9.54e-12 SMART
LY 507 550 2.22e-12 SMART
LY 551 593 1.66e-11 SMART
LY 594 637 5.97e-4 SMART
EGF 664 709 2.16e-1 SMART
transmembrane domain 728 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164746
AA Change: V85A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128193
Gene: ENSMUSG00000024924
AA Change: V85A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 69 1.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165761
SMART Domains Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
LDLa 1 26 1.58e0 SMART
EGF 28 64 4e-5 SMART
LY 88 130 2.16e-1 SMART
LY 132 174 9.54e-12 SMART
LY 175 218 2.22e-12 SMART
LY 219 258 3.25e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167487
AA Change: V85A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: V85A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 797 819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172302
AA Change: V85A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: V85A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 769 791 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
Aars2 T C 17: 45,508,959 Y221H probably damaging Het
Abca8b G A 11: 109,945,822 R1216* probably null Het
Acer2 A G 4: 86,887,050 T84A probably null Het
Adgrb2 A G 4: 130,009,522 N613S probably damaging Het
Arap2 T C 5: 62,641,386 D1300G possibly damaging Het
Ccl11 A T 11: 82,057,839 probably benign Het
Cfh A T 1: 140,088,767 Y1151* probably null Het
Cobll1 A G 2: 65,098,538 S815P probably benign Het
Cryz T C 3: 154,621,568 S240P probably damaging Het
Csmd2 A G 4: 128,511,033 Y2404C Het
F13a1 T C 13: 36,916,886 D428G probably damaging Het
Fbxo42 A G 4: 141,200,085 S559G probably benign Het
Fry A G 5: 150,469,767 S263G Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Gatsl3 T C 11: 4,218,949 C39R probably damaging Het
Gm1527 A G 3: 28,926,541 M597V probably null Het
Gpr158 A T 2: 21,810,601 T602S probably damaging Het
Hmgxb4 C A 8: 75,029,996 T583K probably damaging Het
Igkv8-30 C T 6: 70,117,085 C114Y probably damaging Het
Igsf5 T A 16: 96,403,346 N366K probably damaging Het
Kif15 T C 9: 123,009,926 probably null Het
Klk1b26 T A 7: 44,016,397 probably null Het
Lama1 G T 17: 67,737,705 E200* probably null Het
Lpar5 C T 6: 125,082,384 T356I probably benign Het
Lrch3 A T 16: 32,990,295 T538S probably damaging Het
Mansc4 A G 6: 147,075,705 S138P probably damaging Het
Mief1 T C 15: 80,249,860 S373P possibly damaging Het
Nbas G T 12: 13,520,750 V2053F possibly damaging Het
Nek11 T C 9: 105,244,415 E435G probably damaging Het
Nynrin A T 14: 55,871,923 I1496F probably benign Het
Odf1 A T 15: 38,219,550 M41L probably benign Het
Olfr1209 A T 2: 88,910,364 F10I probably benign Het
Olfr1220 A G 2: 89,097,282 V215A probably benign Het
Olfr713 A G 7: 107,036,157 M8V probably benign Het
Olfr871 T G 9: 20,212,555 S69A probably benign Het
Oxnad1 T C 14: 32,096,516 V106A possibly damaging Het
Padi4 C A 4: 140,761,658 E157* probably null Het
Parp10 A T 15: 76,242,416 F217L probably damaging Het
Pcdhb18 T A 18: 37,490,383 S255R probably benign Het
Pde4c G T 8: 70,745,329 G102W probably damaging Het
Pde6a T C 18: 61,258,224 Y547H probably damaging Het
Phf11b A T 14: 59,326,058 L137I probably benign Het
Pigh A C 12: 79,083,689 I134S probably damaging Het
Pigt G A 2: 164,502,516 V362M probably damaging Het
Pld1 A G 3: 28,024,252 D20G probably damaging Het
Pou3f2 T C 4: 22,487,288 R282G probably damaging Het
Ppp2r5d A G 17: 46,685,601 V382A probably damaging Het
Prdm16 T C 4: 154,341,510 E606G probably damaging Het
Psg28 A G 7: 18,430,584 Y68H probably damaging Het
Qpctl C A 7: 19,149,019 W56L probably damaging Het
Rab11fip5 G A 6: 85,342,155 P584L probably damaging Het
Sde2 C T 1: 180,851,278 H36Y probably benign Het
Sema4d T C 13: 51,702,836 S787G probably benign Het
Shroom3 A G 5: 92,942,604 E1071G probably damaging Het
Skint5 A G 4: 113,580,482 probably null Het
Slc44a3 T A 3: 121,525,762 D110V probably benign Het
Slc4a4 A C 5: 88,934,574 probably benign Het
Slc4a8 A G 15: 100,790,976 D389G probably damaging Het
Sp3 C G 2: 72,979,609 E11Q probably benign Het
Srrm2 A G 17: 23,818,224 S1281G unknown Het
Tat A T 8: 109,996,827 I316F probably benign Het
Thoc5 A G 11: 4,915,563 T381A probably benign Het
Tiam1 T C 16: 89,884,938 Y384C probably damaging Het
Tmem45a A T 16: 56,811,663 F197L probably damaging Het
Trav8d-1 A G 14: 52,778,978 Y107C probably damaging Het
Trim10 T A 17: 36,876,954 V354D probably damaging Het
Unc45b A T 11: 82,940,187 probably null Het
Unc79 A G 12: 103,112,506 I1643M probably benign Het
Unc80 G T 1: 66,521,566 G818* probably null Het
Usp15 A T 10: 123,131,005 M470K possibly damaging Het
Vma21-ps A G 4: 52,496,994 V84A probably benign Het
Vmn2r67 C T 7: 85,136,566 V744I possibly damaging Het
Wdr73 A G 7: 80,893,198 C221R probably benign Het
Zxdc C T 6: 90,378,837 H443Y probably damaging Het
Other mutations in Vldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vldlr APN 19 27239681 missense possibly damaging 0.93
IGL01575:Vldlr APN 19 27246631 missense probably benign
IGL01626:Vldlr APN 19 27243773 missense probably damaging 1.00
IGL02213:Vldlr APN 19 27241326 missense probably benign 0.09
IGL02365:Vldlr APN 19 27245625 missense probably damaging 1.00
IGL02488:Vldlr APN 19 27238275 missense probably damaging 1.00
IGL02708:Vldlr APN 19 27238085 missense possibly damaging 0.92
IGL02947:Vldlr APN 19 27239720 missense probably benign 0.03
r26 UTSW 19 27245654 missense probably damaging 0.99
spotty UTSW 19 27238792 missense probably damaging 1.00
PIT4142001:Vldlr UTSW 19 27234869 missense probably benign 0.05
R0195:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R0288:Vldlr UTSW 19 27240651 splice site probably benign
R0536:Vldlr UTSW 19 27239964 missense probably damaging 1.00
R0537:Vldlr UTSW 19 27247918 missense probably damaging 1.00
R0542:Vldlr UTSW 19 27236255 missense probably benign 0.01
R0594:Vldlr UTSW 19 27234819 missense probably damaging 1.00
R0624:Vldlr UTSW 19 27238263 missense possibly damaging 0.91
R0726:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R1017:Vldlr UTSW 19 27241333 missense probably damaging 1.00
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1443:Vldlr UTSW 19 27239721 missense possibly damaging 0.91
R1493:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1520:Vldlr UTSW 19 27240543 missense probably damaging 0.99
R1520:Vldlr UTSW 19 27247066 missense possibly damaging 0.96
R1657:Vldlr UTSW 19 27245670 missense probably benign 0.00
R1901:Vldlr UTSW 19 27241309 missense probably damaging 1.00
R2047:Vldlr UTSW 19 27234838 missense probably damaging 1.00
R2258:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R2273:Vldlr UTSW 19 27248015 missense probably damaging 1.00
R2423:Vldlr UTSW 19 27236288 missense possibly damaging 0.49
R3196:Vldlr UTSW 19 27243154 missense probably damaging 0.98
R3752:Vldlr UTSW 19 27238331 missense probably damaging 1.00
R3801:Vldlr UTSW 19 27217621 missense probably damaging 0.99
R3835:Vldlr UTSW 19 27234814 missense probably damaging 1.00
R4027:Vldlr UTSW 19 27238313 missense probably benign
R4301:Vldlr UTSW 19 27238402 missense possibly damaging 0.80
R4470:Vldlr UTSW 19 27234819 missense probably damaging 0.96
R4541:Vldlr UTSW 19 27238792 missense probably damaging 1.00
R4765:Vldlr UTSW 19 27240547 missense probably damaging 1.00
R4771:Vldlr UTSW 19 27239890 missense probably damaging 0.97
R4795:Vldlr UTSW 19 27238852 splice site probably null
R4839:Vldlr UTSW 19 27238065 missense probably damaging 1.00
R5074:Vldlr UTSW 19 27238277 missense probably damaging 1.00
R5134:Vldlr UTSW 19 27238812 nonsense probably null
R5281:Vldlr UTSW 19 27244231 missense probably benign 0.44
R5466:Vldlr UTSW 19 27239843 critical splice acceptor site probably null
R5514:Vldlr UTSW 19 27244224 missense probably damaging 0.97
R5886:Vldlr UTSW 19 27243771 missense probably benign 0.03
R5889:Vldlr UTSW 19 27239664 missense probably damaging 1.00
R6110:Vldlr UTSW 19 27238077 missense possibly damaging 0.92
R6343:Vldlr UTSW 19 27245649 missense probably damaging 0.99
R6833:Vldlr UTSW 19 27240574 missense probably damaging 1.00
R6838:Vldlr UTSW 19 27247970 missense probably damaging 1.00
R7169:Vldlr UTSW 19 27244328 missense probably benign
R7304:Vldlr UTSW 19 27238604 missense possibly damaging 0.93
R7403:Vldlr UTSW 19 27236274 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCTAGAGATGCCAACAATTTG -3'
(R):5'- CAGTTGGCCTCAAGTTTCAGG -3'

Sequencing Primer
(F):5'- GCCAACAATTTGAATATCAGTCAGC -3'
(R):5'- CCTCAAGTTTCAGGCAGGCAAAG -3'
Posted On2019-06-26