Incidental Mutation 'R0591:Tnks2'
ID56008
Institutional Source Beutler Lab
Gene Symbol Tnks2
Ensembl Gene ENSMUSG00000024811
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Synonyms
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0591 (G1)
Quality Score187
Status Validated
Chromosome19
Chromosomal Location36834232-36893477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36872562 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 605 (Y605N)
Ref Sequence ENSEMBL: ENSMUSP00000025729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025729] [ENSMUST00000164665] [ENSMUST00000167724]
Predicted Effect probably damaging
Transcript: ENSMUST00000025729
AA Change: Y605N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025729
Gene: ENSMUSG00000024811
AA Change: Y605N

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ANK 57 86 8.07e-5 SMART
ANK 90 119 1.78e-6 SMART
ANK 123 152 6.46e-4 SMART
ANK 210 239 1.76e-5 SMART
ANK 243 272 3.91e-3 SMART
ANK 276 305 3.23e-4 SMART
ANK 363 395 1.57e-2 SMART
ANK 399 428 4.5e-3 SMART
ANK 432 461 4.89e-4 SMART
ANK 525 554 1.43e-5 SMART
ANK 558 587 6.55e-5 SMART
ANK 591 620 1.24e-5 SMART
low complexity region 641 659 N/A INTRINSIC
ANK 678 707 1.69e-7 SMART
ANK 711 740 3.65e-3 SMART
ANK 744 773 3.36e-2 SMART
low complexity region 822 863 N/A INTRINSIC
SAM 870 936 1.03e-10 SMART
Pfam:PARP 952 1157 4.9e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164665
AA Change: Y50N

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132440
Gene: ENSMUSG00000024811
AA Change: Y50N

DomainStartEndE-ValueType
ANK 3 32 6.55e-5 SMART
ANK 36 65 1.24e-5 SMART
low complexity region 86 104 N/A INTRINSIC
ANK 123 152 1.69e-7 SMART
ANK 156 185 9.05e2 SMART
low complexity region 204 245 N/A INTRINSIC
SAM 252 318 1.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167724
SMART Domains Protein: ENSMUSP00000126888
Gene: ENSMUSG00000024811

DomainStartEndE-ValueType
ANK 84 113 4.89e-4 SMART
Blast:ANK 143 171 9e-10 BLAST
ANK 177 206 1.43e-5 SMART
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable but display decreased body weight and abnormal adipocyte glucose uptake in response to insulin stimulation. Mice homozygous for a different null allele show partial postnatal lethality as well as decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Tnks2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Tnks2 APN 19 36871633 missense probably benign 0.00
IGL01977:Tnks2 APN 19 36872590 critical splice donor site probably null
IGL02389:Tnks2 APN 19 36884103 missense probably benign 0.32
IGL02653:Tnks2 APN 19 36872451 missense probably damaging 1.00
IGL02678:Tnks2 APN 19 36845743 missense possibly damaging 0.63
R0053:Tnks2 UTSW 19 36875365 missense probably damaging 1.00
R0053:Tnks2 UTSW 19 36875365 missense probably damaging 1.00
R0426:Tnks2 UTSW 19 36852821 missense probably damaging 1.00
R0436:Tnks2 UTSW 19 36849358 missense possibly damaging 0.51
R0648:Tnks2 UTSW 19 36862074 splice site probably null
R0894:Tnks2 UTSW 19 36890050 critical splice donor site probably null
R1397:Tnks2 UTSW 19 36880501 splice site probably benign
R1459:Tnks2 UTSW 19 36845531 splice site probably benign
R1674:Tnks2 UTSW 19 36871622 missense probably benign 0.03
R1742:Tnks2 UTSW 19 36876261 missense probably damaging 1.00
R1928:Tnks2 UTSW 19 36845668 nonsense probably null
R2025:Tnks2 UTSW 19 36866066 missense probably damaging 0.99
R2898:Tnks2 UTSW 19 36872590 critical splice donor site probably null
R4422:Tnks2 UTSW 19 36845653 missense probably damaging 1.00
R4676:Tnks2 UTSW 19 36875271 nonsense probably null
R5202:Tnks2 UTSW 19 36888852 missense probably damaging 1.00
R5357:Tnks2 UTSW 19 36849290 splice site silent
R5467:Tnks2 UTSW 19 36881776 missense probably damaging 1.00
R5550:Tnks2 UTSW 19 36862346 missense probably damaging 1.00
R6119:Tnks2 UTSW 19 36879352 missense possibly damaging 0.79
R6219:Tnks2 UTSW 19 36866204 intron probably benign
R7270:Tnks2 UTSW 19 36859145 missense
R7309:Tnks2 UTSW 19 36852536 missense probably damaging 1.00
R7310:Tnks2 UTSW 19 36879439 missense probably benign 0.12
R7516:Tnks2 UTSW 19 36871664 missense not run
Predicted Primers PCR Primer
(F):5'- ACATGCAGATGGCTCGGATTTACG -3'
(R):5'- ACAGCAACTATCACATGATAGGTGGC -3'

Sequencing Primer
(F):5'- TGACCAGAATACTCTATTGGGCAG -3'
(R):5'- TCCTTGGTTTAAGACTCATATTTCTG -3'
Posted On2013-07-11