Incidental Mutation 'R7199:Plxna4'
ID560156
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R7199 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 32215178 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 826 (Q826*)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect probably null
Transcript: ENSMUST00000115096
AA Change: Q826*
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: Q826*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A G 16: 88,759,014 T39A probably damaging Het
5430419D17Rik G A 7: 131,235,912 W512* probably null Het
Abca3 G A 17: 24,377,707 G378D probably damaging Het
Abtb2 T C 2: 103,567,220 V165A possibly damaging Het
Ache A G 5: 137,290,242 E70G probably damaging Het
Adamtsl4 T C 3: 95,680,809 T623A probably benign Het
Ahdc1 G A 4: 133,064,624 V1059I probably benign Het
Ajuba G A 14: 54,573,458 Q357* probably null Het
Ano7 A T 1: 93,402,978 D54V Het
Apob A T 12: 8,005,072 D1357V probably damaging Het
Atad2b T A 12: 5,017,992 Y997N probably damaging Het
Bhlhe22 C A 3: 18,055,842 T352K probably damaging Het
Bsn T C 9: 108,115,334 E1073G probably damaging Het
Bzw2 G A 12: 36,130,055 R58* probably null Het
C7 G T 15: 4,994,243 S694R probably benign Het
Cbr2 T A 11: 120,730,261 H170L probably benign Het
Ckap2l T C 2: 129,285,055 N401S probably benign Het
Cldn1 A G 16: 26,371,596 F11L probably benign Het
Cmtr1 A G 17: 29,676,200 T118A probably benign Het
Cog6 T C 3: 52,983,189 E610G probably benign Het
Col3a1 G T 1: 45,332,141 A451S probably null Het
Cr1l T A 1: 195,117,570 R265S probably benign Het
Dapk1 T C 13: 60,754,210 I951T probably benign Het
Dnah9 T C 11: 66,118,944 N706D probably benign Het
Dpysl5 A T 5: 30,783,195 T239S probably benign Het
Ect2l T A 10: 18,129,146 Y913F probably benign Het
Elf5 C A 2: 103,439,296 A74D possibly damaging Het
Erap1 T C 13: 74,666,139 V399A probably benign Het
Ercc4 A G 16: 13,147,793 D763G probably damaging Het
Fam222b T A 11: 78,154,857 C415S possibly damaging Het
Fat4 A C 3: 38,977,362 N2432T probably damaging Het
Fbn2 G T 18: 58,053,761 C1689* probably null Het
Frrs1l T A 4: 56,972,282 T140S probably damaging Het
Gm14025 A G 2: 129,038,318 S563P Het
Gm5141 A T 13: 62,777,063 H10Q possibly damaging Het
Inafm1 A T 7: 16,273,154 L46Q probably damaging Het
Irak2 T C 6: 113,673,084 L260P probably damaging Het
Kat2b T C 17: 53,670,678 L751P probably damaging Het
Kcnh1 T A 1: 192,337,605 I413N probably benign Het
Kirrel T C 3: 87,083,388 D709G probably benign Het
Lama4 T C 10: 39,080,540 V1153A possibly damaging Het
Lipg A T 18: 74,955,584 F98L probably benign Het
Lman1 T C 18: 65,994,865 E236G probably damaging Het
Lrp1 T A 10: 127,573,456 D1598V probably damaging Het
Lrrc71 T A 3: 87,743,077 N230Y probably damaging Het
Maneal T C 4: 124,857,190 S258G possibly damaging Het
March10 T A 11: 105,390,706 E251V probably damaging Het
Mb21d1 C A 9: 78,433,033 K472N probably benign Het
Mpdz A G 4: 81,297,333 I1484T probably damaging Het
Mtcl1 T A 17: 66,340,539 N1882I probably benign Het
Neb G A 2: 52,220,200 A212V probably benign Het
Obscn G A 11: 59,012,846 S7434L probably benign Het
Olfr1297 T C 2: 111,621,193 M294V probably benign Het
Olfr340 A T 2: 36,452,860 I92F probably damaging Het
Olfr51 T A 11: 51,007,396 C141* probably null Het
Olfr761 A C 17: 37,952,157 I289S probably damaging Het
Olfr971 A G 9: 39,839,457 M8V probably benign Het
Orc6 T C 8: 85,302,961 probably null Het
Otogl T G 10: 107,874,533 E565A possibly damaging Het
Papss1 A G 3: 131,585,138 Q214R probably benign Het
Pck2 G A 14: 55,548,712 V653M probably benign Het
Pms1 T A 1: 53,256,730 T161S probably benign Het
Prkar2a C A 9: 108,740,470 N242K probably damaging Het
Prss1 T A 6: 41,462,756 I141N probably damaging Het
Puf60 A G 15: 76,071,868 V235A probably damaging Het
Rapgef6 T A 11: 54,546,426 F65Y probably benign Het
Rasgef1b T C 5: 99,300,039 E104G unknown Het
Rcn3 T C 7: 45,084,909 Y225C probably damaging Het
Rhot1 G C 11: 80,246,734 W354S probably damaging Het
Rp1 T C 1: 4,347,290 S1200G possibly damaging Het
Scaper T A 9: 55,838,176 K603* probably null Het
Selenbp1 G A 3: 94,944,434 V429I possibly damaging Het
Setd5 T G 6: 113,121,138 S713A probably benign Het
Shank1 T C 7: 44,353,140 Y1428H possibly damaging Het
Slc11a1 G T 1: 74,383,671 W361L possibly damaging Het
Spta1 A T 1: 174,223,271 D1772V possibly damaging Het
St8sia6 T C 2: 13,656,910 H370R probably damaging Het
Stkld1 A T 2: 26,952,714 D566V probably damaging Het
Tango6 T C 8: 106,689,159 V204A probably benign Het
Tdrd5 G A 1: 156,301,723 A139V probably damaging Het
Tenm2 A T 11: 36,171,436 V534E probably damaging Het
Tfip11 A T 5: 112,331,178 Q204L probably benign Het
Tlr4 A T 4: 66,841,193 Q741L probably damaging Het
Tmem18 A G 12: 30,588,655 M111V probably benign Het
Togaram1 A G 12: 64,995,518 N1167S probably benign Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Trbj2-3 T C 6: 41,543,242 F7S probably damaging Het
Vmn1r212 T A 13: 22,883,561 M201L probably benign Het
Xaf1 C A 11: 72,303,375 C27* probably null Het
Zeb1 T C 18: 5,767,703 V738A probably benign Het
Zfp524 A T 7: 5,017,884 H137L probably damaging Het
Zfyve19 A T 2: 119,216,637 H367L probably damaging Het
Zim1 G A 7: 6,677,873 Q264* probably null Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
inclined UTSW 6 32237723 nonsense probably null
slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 intron probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32496756 missense probably benign 0.01
R7248:Plxna4 UTSW 6 32162160 missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32239520 missense possibly damaging 0.79
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGATTGATGCAGGTGACC -3'
(R):5'- GCTGAGACCAAATGGAGATTCAC -3'

Sequencing Primer
(F):5'- CATAGCTAGGCCCTATCTTGAGAG -3'
(R):5'- CAAATGGAGATTCACAGTTTCCCGG -3'
Posted On2019-06-26