Incidental Mutation 'R7200:Rars2'
ID560227
Institutional Source Beutler Lab
Gene Symbol Rars2
Ensembl Gene ENSMUSG00000028292
Gene Namearginyl-tRNA synthetase 2, mitochondrial
Synonyms1500002I10Rik, Rarsl, PRO1992
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7200 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location34614957-34660167 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34645747 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 221 (K221N)
Ref Sequence ENSEMBL: ENSMUSP00000029968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029968]
Predicted Effect probably benign
Transcript: ENSMUST00000029968
AA Change: K221N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000029968
Gene: ENSMUSG00000028292
AA Change: K221N

DomainStartEndE-ValueType
Pfam:tRNA-synt_1d 110 449 1e-97 PFAM
DALR_1 463 578 3.64e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a protein that localizes to the mitochondria, where it catalyzes the transfer of L-arginine to its cognate tRNA, an important step in translation of mitochondrially-encoded proteins. Defects in this gene are a cause of pontocerebellar hypoplasia type 6 (PCH6). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,153,010 M75T unknown Het
2700049A03Rik T G 12: 71,140,906 N105K probably damaging Het
Acvr1c A T 2: 58,315,855 V31E probably damaging Het
Adra1d T A 2: 131,561,250 T307S probably benign Het
Akr1c14 T C 13: 4,081,051 Y248H probably benign Het
Ankub1 T C 3: 57,672,985 T84A probably benign Het
Asb3 C A 11: 30,998,348 S8* probably null Het
AU041133 G A 10: 82,151,101 G196D possibly damaging Het
B4galt7 T C 13: 55,608,342 C214R probably damaging Het
Chd3 A G 11: 69,364,095 S140P possibly damaging Het
Ciz1 T C 2: 32,364,287 L80P probably damaging Het
Col6a4 G A 9: 106,072,249 P729L possibly damaging Het
Cr2 A G 1: 195,163,249 C133R probably damaging Het
Dmgdh T C 13: 93,691,885 L178P probably damaging Het
Dock5 C A 14: 67,771,702 E1448* probably null Het
Elavl1 A G 8: 4,311,767 S2P probably benign Het
Flywch1 T C 17: 23,761,059 H247R possibly damaging Het
Gabpb1 A T 2: 126,639,302 I309N possibly damaging Het
Glrx3 T C 7: 137,464,436 F298L possibly damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Gpc6 G A 14: 117,964,856 V493I probably benign Het
H2-Bl A T 17: 36,081,046 I45N possibly damaging Het
Hadha C T 5: 30,145,317 E78K probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Ldlrad3 G T 2: 102,113,558 F56L probably damaging Het
Ldlrad3 A G 2: 102,113,560 F56L probably damaging Het
Mapk4 A T 18: 73,930,919 S411T possibly damaging Het
Mcm9 A G 10: 53,615,923 M382T Het
Olfr1457 T C 19: 13,095,232 T139A probably benign Het
Olfr720 A T 14: 14,175,477 C202S probably damaging Het
Pacs1 A C 19: 5,156,413 I248S possibly damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plekhg1 T C 10: 3,956,810 S631P Het
Retsat T C 6: 72,606,019 S388P possibly damaging Het
Rft1 G A 14: 30,682,857 probably null Het
Rgsl1 A G 1: 153,785,199 V345A probably benign Het
Rnf38 A T 4: 44,137,620 S320R probably benign Het
Sel1l3 T A 5: 53,144,109 Y722F probably benign Het
Slc13a4 T C 6: 35,287,350 E194G possibly damaging Het
Spata17 G A 1: 187,112,503 R300C probably benign Het
Tacc1 G A 8: 25,241,640 probably benign Het
Tc2n T G 12: 101,689,055 I214L probably damaging Het
Tet2 T C 3: 133,487,192 S494G probably benign Het
Tmco5b A T 2: 113,291,377 I179L probably damaging Het
Triobp AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA AGGGACAA 15: 78,966,842 probably benign Het
Trpv1 A G 11: 73,239,586 T173A probably damaging Het
Vmn2r56 C T 7: 12,710,332 G458R probably damaging Het
Vmn2r81 T G 10: 79,270,736 probably null Het
Wfdc15b T A 2: 164,215,117 E80D probably benign Het
Wrn A T 8: 33,322,348 D423E probably benign Het
Zfp775 T A 6: 48,620,481 C430S possibly damaging Het
Other mutations in Rars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02121:Rars2 APN 4 34657219 missense probably damaging 1.00
IGL02143:Rars2 APN 4 34623404 splice site probably benign
IGL02378:Rars2 APN 4 34656199 missense possibly damaging 0.51
IGL03035:Rars2 APN 4 34656865 critical splice donor site probably null
IGL03148:Rars2 APN 4 34650243 missense possibly damaging 0.82
R0238:Rars2 UTSW 4 34645838 missense probably damaging 1.00
R0238:Rars2 UTSW 4 34656030 missense probably benign 0.00
R0238:Rars2 UTSW 4 34645838 missense probably damaging 1.00
R0238:Rars2 UTSW 4 34656030 missense probably benign 0.00
R0671:Rars2 UTSW 4 34630505 nonsense probably null
R0967:Rars2 UTSW 4 34646587 missense probably benign 0.01
R2276:Rars2 UTSW 4 34656835 missense probably damaging 0.96
R3726:Rars2 UTSW 4 34645787 missense probably benign
R4642:Rars2 UTSW 4 34656229 missense probably damaging 1.00
R5144:Rars2 UTSW 4 34656793 missense probably benign 0.00
R5714:Rars2 UTSW 4 34645779 missense probably benign 0.00
R5919:Rars2 UTSW 4 34657232 missense probably damaging 0.98
R5946:Rars2 UTSW 4 34656855 missense possibly damaging 0.46
X0011:Rars2 UTSW 4 34652176 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCATGCTACTTTGATTAGCC -3'
(R):5'- TGTAAGCAGCAGCACTAGCC -3'

Sequencing Primer
(F):5'- GATCCCAAACTGTCAGCTTAATG -3'
(R):5'- GCAGCACTAGCCAAGCG -3'
Posted On2019-06-26