Incidental Mutation 'R7201:BC034090'
ID560269
Institutional Source Beutler Lab
Gene Symbol BC034090
Ensembl Gene ENSMUSG00000033722
Gene NamecDNA sequence BC034090
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7201 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location155212471-155244444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155241934 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 146 (V146A)
Ref Sequence ENSEMBL: ENSMUSP00000139623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186156]
Predicted Effect probably damaging
Transcript: ENSMUST00000186156
AA Change: V146A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139623
Gene: ENSMUSG00000033722
AA Change: V146A

DomainStartEndE-ValueType
low complexity region 446 463 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 855 861 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
PDZ 1123 1198 2.2e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,291,627 M1850V probably benign Het
4933406M09Rik A G 1: 134,390,468 D326G possibly damaging Het
Acaca A G 11: 84,262,474 T903A probably benign Het
Acin1 A T 14: 54,664,899 S479T possibly damaging Het
Actr6 A T 10: 89,712,512 D370E probably benign Het
Adgrl3 T C 5: 81,724,222 F921S probably damaging Het
Ankmy1 A T 1: 92,886,824 H320Q possibly damaging Het
Arhgef5 C T 6: 43,273,232 Q306* probably null Het
Arntl T A 7: 113,285,142 M122K probably damaging Het
Art4 A T 6: 136,854,549 V198E probably benign Het
Asph G A 4: 9,474,917 R686W probably damaging Het
Atg7 A G 6: 114,777,057 H724R probably damaging Het
B020004J07Rik T A 4: 101,838,141 probably null Het
Bcl2a1d T A 9: 88,731,586 Q45L probably damaging Het
Ccdc36 A T 9: 108,404,775 D571E probably damaging Het
Cd28 G T 1: 60,763,173 E84* probably null Het
Ceacam3 G A 7: 17,158,238 W302* probably null Het
Cerkl T C 2: 79,333,590 N462S probably benign Het
Cisd2 A T 3: 135,411,213 L39H probably damaging Het
Col11a1 C A 3: 114,090,157 T225K unknown Het
Col15a1 A T 4: 47,307,752 Y1178F possibly damaging Het
Cul4a T C 8: 13,142,991 S630P probably damaging Het
Cyp2c38 T A 19: 39,401,776 I327F probably damaging Het
Cyp3a25 A C 5: 145,991,447 S263A probably benign Het
Cyp3a25 T A 5: 146,003,058 L46F probably benign Het
Dmrta1 T A 4: 89,692,171 L456* probably null Het
Dnah12 T C 14: 26,814,622 L2165P probably benign Het
Dsg1a C A 18: 20,328,311 S253R probably damaging Het
Egln2 A C 7: 27,160,319 I323S probably damaging Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fcgr2b G T 1: 170,963,397 Q276K probably benign Het
Fcrls C T 3: 87,252,627 C440Y probably damaging Het
Fmnl2 T C 2: 53,073,654 V266A unknown Het
Glo1 A T 17: 30,597,854 D109E probably benign Het
Grin3b A G 10: 79,974,078 R473G possibly damaging Het
Ica1 G A 6: 8,644,015 L425F probably damaging Het
Kcnq5 T C 1: 21,402,875 E716G possibly damaging Het
Klra17 A T 6: 129,873,343 I48K possibly damaging Het
Lrrc66 G T 5: 73,629,897 Q37K probably benign Het
Ly6a T A 15: 74,996,476 T55S probably benign Het
Lyst T A 13: 13,709,300 Y2924* probably null Het
Lyzl6 A G 11: 103,631,351 Y140H probably benign Het
Mak T C 13: 41,051,440 I141V possibly damaging Het
Mapk7 A G 11: 61,489,172 I789T probably benign Het
Mrpl4 T C 9: 21,007,338 I123T probably benign Het
Myh7 T C 14: 54,990,945 T235A possibly damaging Het
Myo18b C T 5: 112,715,459 C2171Y probably damaging Het
Nat8 A T 6: 85,830,895 Y85* probably null Het
Nyap1 A T 5: 137,736,262 S170T probably damaging Het
Ogfr AGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,094 probably benign Het
Olfr392 A G 11: 73,814,341 V247A probably benign Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Papss1 T C 3: 131,599,926 L244P probably damaging Het
Pibf1 A T 14: 99,196,408 D597V probably damaging Het
Pmpcb T A 5: 21,737,179 M1K probably null Het
Ppwd1 G A 13: 104,207,172 P575L probably damaging Het
Prc1 A G 7: 80,311,089 Q457R possibly damaging Het
Prdm10 T C 9: 31,316,306 V69A possibly damaging Het
Prkdc A G 16: 15,698,803 I1014V probably benign Het
Rab3gap2 A G 1: 185,267,191 Y999C probably damaging Het
Robo3 G A 9: 37,424,330 Q539* probably null Het
Rps12 A G 10: 23,785,231 Y127H probably benign Het
Sar1b A G 11: 51,788,252 D116G probably benign Het
Selenbp2 C T 3: 94,702,357 P294L probably benign Het
Slc6a2 T C 8: 92,995,672 Y516H probably damaging Het
Slit2 A G 5: 48,237,285 N673S probably null Het
Srpk2 A G 5: 23,507,628 F653L possibly damaging Het
Supt5 A T 7: 28,316,788 S824T probably benign Het
Taar7a A G 10: 23,992,460 V341A probably benign Het
Tmem52 G A 4: 155,470,321 G134R probably damaging Het
Ush2a A G 1: 188,874,754 T3949A probably benign Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 85,022,855 probably null Het
Vmn1r173 A T 7: 23,702,158 probably benign Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vwce A G 19: 10,638,115 E120G possibly damaging Het
Zfp143 T C 7: 110,093,080 V566A possibly damaging Het
Other mutations in BC034090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:BC034090 APN 1 155225447 missense possibly damaging 0.95
IGL00159:BC034090 APN 1 155225451 nonsense probably null
IGL00481:BC034090 APN 1 155232521 missense probably benign 0.04
IGL01309:BC034090 APN 1 155226384 missense probably damaging 0.98
IGL01813:BC034090 APN 1 155226339 nonsense probably null
IGL01938:BC034090 APN 1 155232592 splice site probably null
IGL01982:BC034090 APN 1 155223332 missense probably damaging 1.00
IGL02115:BC034090 APN 1 155232651 intron probably benign
IGL02338:BC034090 APN 1 155217471 missense probably damaging 1.00
IGL02406:BC034090 APN 1 155225153 missense probably benign 0.00
IGL03243:BC034090 APN 1 155225655 missense possibly damaging 0.71
IGL03290:BC034090 APN 1 155226110 missense probably damaging 1.00
R0055:BC034090 UTSW 1 155241658 missense probably damaging 1.00
R1436:BC034090 UTSW 1 155225916 missense probably benign 0.04
R1649:BC034090 UTSW 1 155225573 missense possibly damaging 0.72
R1710:BC034090 UTSW 1 155225864 missense possibly damaging 0.82
R1819:BC034090 UTSW 1 155225829 missense possibly damaging 0.58
R1969:BC034090 UTSW 1 155225226 missense possibly damaging 0.90
R1996:BC034090 UTSW 1 155221594 unclassified probably benign
R2012:BC034090 UTSW 1 155221432 missense probably damaging 0.98
R2133:BC034090 UTSW 1 155225786 missense probably benign 0.27
R3426:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3427:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3428:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3782:BC034090 UTSW 1 155226278 missense probably damaging 1.00
R3792:BC034090 UTSW 1 155241797 missense probably damaging 0.98
R4234:BC034090 UTSW 1 155241580 missense probably benign
R4373:BC034090 UTSW 1 155226158 missense probably benign 0.22
R4377:BC034090 UTSW 1 155232450 missense probably benign 0.00
R4661:BC034090 UTSW 1 155232475 missense probably damaging 0.98
R4676:BC034090 UTSW 1 155226264 missense possibly damaging 0.60
R4729:BC034090 UTSW 1 155225090 missense probably damaging 1.00
R5170:BC034090 UTSW 1 155213650 missense probably damaging 1.00
R5340:BC034090 UTSW 1 155226414 missense possibly damaging 0.74
R5382:BC034090 UTSW 1 155225603 missense probably benign 0.09
R5384:BC034090 UTSW 1 155242027 missense possibly damaging 0.68
R5576:BC034090 UTSW 1 155241468 missense probably benign 0.01
R5891:BC034090 UTSW 1 155233047 unclassified probably benign
R6060:BC034090 UTSW 1 155241499 missense probably benign 0.00
R6092:BC034090 UTSW 1 155224913 missense probably damaging 0.99
R6662:BC034090 UTSW 1 155226339 missense possibly damaging 0.92
R6736:BC034090 UTSW 1 155241930 missense possibly damaging 0.92
R6903:BC034090 UTSW 1 155221385 missense probably benign 0.03
R6970:BC034090 UTSW 1 155241439 missense probably damaging 1.00
R7144:BC034090 UTSW 1 155242031 missense probably damaging 1.00
R7265:BC034090 UTSW 1 155225327 missense probably damaging 0.96
R7380:BC034090 UTSW 1 155232483 missense probably damaging 1.00
X0002:BC034090 UTSW 1 155226279 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCTGGACTGCAGAAACTC -3'
(R):5'- TCCAAGGTCCTTCTGTGCTG -3'

Sequencing Primer
(F):5'- CTGCAGAAACTCGATTGTTGGGAC -3'
(R):5'- CCTTCTGTGCTGGAGTCCAAG -3'
Posted On2019-06-26