Incidental Mutation 'R0592:Vezf1'
ID56029
Institutional Source Beutler Lab
Gene Symbol Vezf1
Ensembl Gene ENSMUSG00000018377
Gene Namevascular endothelial zinc finger 1
Synonymsdb1
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0592 (G1)
Quality Score187
Status Not validated
Chromosome11
Chromosomal Location88068279-88084729 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) A to T at 88068435 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000018521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018521]
Predicted Effect probably benign
Transcript: ENSMUST00000018521
SMART Domains Protein: ENSMUSP00000018521
Gene: ENSMUSG00000018377

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
ZnF_C2H2 74 96 3.83e-2 SMART
low complexity region 137 172 N/A INTRINSIC
ZnF_C2H2 174 196 6.78e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 232 255 1.1e-2 SMART
ZnF_C2H2 261 283 3.16e-3 SMART
ZnF_C2H2 287 308 2.61e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156149
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcriptional regulatory proteins containing tandemly repeated zinc finger domains are thought to be involved in both normal and abnormal cellular proliferation and differentiation. ZNF161 is a C2H2-type zinc finger protein (Koyano-Nakagawa et al., 1994 [PubMed 8035792]). See MIM 603971 for general information on zinc finger proteins.[supplied by OMIM, Sep 2008]
PHENOTYPE: Homozygous null mice die at midgestation due to angiogenic remodeling defects and loss of vascular integrity leading to hemorrhaging in the head, heart and trunk. One fifth of heterozygous null embryos show lymphatic hypervascularization associated with hemorrhaging and edema in the jugular region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Vezf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Vezf1 APN 11 88073494 missense probably benign 0.14
IGL00576:Vezf1 APN 11 88073644 nonsense probably null
IGL02683:Vezf1 APN 11 88076327 missense probably benign 0.36
IGL02700:Vezf1 APN 11 88073303 missense probably damaging 0.97
IGL02701:Vezf1 APN 11 88076221 nonsense probably null
R0541:Vezf1 UTSW 11 88081577 missense possibly damaging 0.77
R0591:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0725:Vezf1 UTSW 11 88073330 missense probably benign 0.04
R0758:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0803:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0853:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0854:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R1491:Vezf1 UTSW 11 88073747 missense probably damaging 1.00
R1605:Vezf1 UTSW 11 88076299 missense possibly damaging 0.75
R1781:Vezf1 UTSW 11 88081621 missense probably benign 0.28
R3898:Vezf1 UTSW 11 88076173 missense probably benign
R4656:Vezf1 UTSW 11 88074667 missense probably damaging 1.00
R4868:Vezf1 UTSW 11 88074694 missense probably damaging 1.00
R5946:Vezf1 UTSW 11 88073734 nonsense probably null
R6190:Vezf1 UTSW 11 88076186 missense probably benign 0.02
R6258:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6260:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6452:Vezf1 UTSW 11 88081670 missense possibly damaging 0.66
R6680:Vezf1 UTSW 11 88081584 missense probably benign 0.23
R6983:Vezf1 UTSW 11 88073319 missense possibly damaging 0.88
R7086:Vezf1 UTSW 11 88078538 missense probably benign 0.00
R7322:Vezf1 UTSW 11 88081584 missense possibly damaging 0.68
R7443:Vezf1 UTSW 11 88074663 missense probably damaging 1.00
X0019:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
X0067:Vezf1 UTSW 11 88081728 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TCCCGGAGGTTACCGGAAGTGG -3'
(R):5'- TGGCGGCGAAGCCAGAGATACC -3'

Sequencing Primer
(F):5'- GCTGCCATGTTGAGGAgc -3'
(R):5'- AGGGTCAGAAAGTCAACACAC -3'
Posted On2013-07-11