Incidental Mutation 'R7201:Myh7'
ID560333
Institutional Source Beutler Lab
Gene Symbol Myh7
Ensembl Gene ENSMUSG00000053093
Gene Namemyosin, heavy polypeptide 7, cardiac muscle, beta
SynonymsMyhcb, Myhc-b, MyHC-I, B-MHC, MYH-beta/slow, beta-MHC
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R7201 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54970684-54994626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54990945 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 235 (T235A)
Ref Sequence ENSEMBL: ENSMUSP00000099867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102803] [ENSMUST00000153783] [ENSMUST00000168485] [ENSMUST00000226424] [ENSMUST00000227518] [ENSMUST00000228837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102803
AA Change: T235A

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099867
Gene: ENSMUSG00000053093
AA Change: T235A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 73 3.8e-16 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
Pfam:Myosin_tail_1 843 1924 5.6e-168 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153783
SMART Domains Protein: ENSMUSP00000116595
Gene: ENSMUSG00000053093

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 61 8.8e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168485
AA Change: T235A

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126840
Gene: ENSMUSG00000053093
AA Change: T235A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 75 1.6e-17 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
PDB:2FXO|D 838 963 6e-53 PDB
Pfam:Myosin_tail_1 1068 1926 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226424
Predicted Effect probably benign
Transcript: ENSMUST00000227518
Predicted Effect probably benign
Transcript: ENSMUST00000228837
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing early-onset distal myopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,291,627 M1850V probably benign Het
4933406M09Rik A G 1: 134,390,468 D326G possibly damaging Het
Acaca A G 11: 84,262,474 T903A probably benign Het
Acin1 A T 14: 54,664,899 S479T possibly damaging Het
Actr6 A T 10: 89,712,512 D370E probably benign Het
Adgrl3 T C 5: 81,724,222 F921S probably damaging Het
Ankmy1 A T 1: 92,886,824 H320Q possibly damaging Het
Arhgef5 C T 6: 43,273,232 Q306* probably null Het
Arntl T A 7: 113,285,142 M122K probably damaging Het
Art4 A T 6: 136,854,549 V198E probably benign Het
Asph G A 4: 9,474,917 R686W probably damaging Het
Atg7 A G 6: 114,777,057 H724R probably damaging Het
B020004J07Rik T A 4: 101,838,141 probably null Het
BC034090 A G 1: 155,241,934 V146A probably damaging Het
Bcl2a1d T A 9: 88,731,586 Q45L probably damaging Het
Ccdc36 A T 9: 108,404,775 D571E probably damaging Het
Cd28 G T 1: 60,763,173 E84* probably null Het
Ceacam3 G A 7: 17,158,238 W302* probably null Het
Cerkl T C 2: 79,333,590 N462S probably benign Het
Cisd2 A T 3: 135,411,213 L39H probably damaging Het
Col11a1 C A 3: 114,090,157 T225K unknown Het
Col15a1 A T 4: 47,307,752 Y1178F possibly damaging Het
Cul4a T C 8: 13,142,991 S630P probably damaging Het
Cyp2c38 T A 19: 39,401,776 I327F probably damaging Het
Cyp3a25 A C 5: 145,991,447 S263A probably benign Het
Cyp3a25 T A 5: 146,003,058 L46F probably benign Het
D17Wsu92e A C 17: 27,794,070 probably null Het
Dmrta1 T A 4: 89,692,171 L456* probably null Het
Dnah12 T C 14: 26,814,622 L2165P probably benign Het
Dsg1a C A 18: 20,328,311 S253R probably damaging Het
Egln2 A C 7: 27,160,319 I323S probably damaging Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fcgr2b G T 1: 170,963,397 Q276K probably benign Het
Fcrls C T 3: 87,252,627 C440Y probably damaging Het
Fmnl2 T C 2: 53,073,654 V266A unknown Het
Glo1 A T 17: 30,597,854 D109E probably benign Het
Grin3b A G 10: 79,974,078 R473G possibly damaging Het
Ica1 G A 6: 8,644,015 L425F probably damaging Het
Kcnq5 T C 1: 21,402,875 E716G possibly damaging Het
Klra17 A T 6: 129,873,343 I48K possibly damaging Het
Lrrc66 G T 5: 73,629,897 Q37K probably benign Het
Ly6a T A 15: 74,996,476 T55S probably benign Het
Lyst T A 13: 13,709,300 Y2924* probably null Het
Lyzl6 A G 11: 103,631,351 Y140H probably benign Het
Mak T C 13: 41,051,440 I141V possibly damaging Het
Mapk7 A G 11: 61,489,172 I789T probably benign Het
Mrpl4 T C 9: 21,007,338 I123T probably benign Het
Mup18 G C 4: 61,673,336 probably null Het
Myef2 T C 2: 125,096,162 probably null Het
Myo18b C T 5: 112,715,459 C2171Y probably damaging Het
Nat8 A T 6: 85,830,895 Y85* probably null Het
Nyap1 A T 5: 137,736,262 S170T probably damaging Het
Ogfr AGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,094 probably benign Het
Olfr392 A G 11: 73,814,341 V247A probably benign Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr718-ps1 A G 5: 143,137,798 Y157H probably damaging Het
Papss1 T C 3: 131,599,926 L244P probably damaging Het
Pibf1 A T 14: 99,196,408 D597V probably damaging Het
Pmpcb T A 5: 21,737,179 M1K probably null Het
Ppwd1 G A 13: 104,207,172 P575L probably damaging Het
Prc1 A G 7: 80,311,089 Q457R possibly damaging Het
Prdm10 T C 9: 31,316,306 V69A possibly damaging Het
Prkdc A G 16: 15,698,803 I1014V probably benign Het
Rab3gap2 A G 1: 185,267,191 Y999C probably damaging Het
Robo3 G A 9: 37,424,330 Q539* probably null Het
Rps12 A G 10: 23,785,231 Y127H probably benign Het
Sar1b A G 11: 51,788,252 D116G probably benign Het
Selenbp2 C T 3: 94,702,357 P294L probably benign Het
Slc6a2 T C 8: 92,995,672 Y516H probably damaging Het
Slit2 A G 5: 48,237,285 N673S probably null Het
Snap91 A T 9: 86,790,146 probably null Het
Srpk2 A G 5: 23,507,628 F653L possibly damaging Het
Supt5 A T 7: 28,316,788 S824T probably benign Het
Taar7a A G 10: 23,992,460 V341A probably benign Het
Tmem52 G A 4: 155,470,321 G134R probably damaging Het
Ush2a A G 1: 188,874,754 T3949A probably benign Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 85,022,855 probably null Het
Vmn1r173 A T 7: 23,702,158 probably benign Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vwce A G 19: 10,638,115 E120G possibly damaging Het
Zfp143 T C 7: 110,093,080 V566A possibly damaging Het
Other mutations in Myh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Myh7 APN 14 54987388 missense probably damaging 1.00
IGL01025:Myh7 APN 14 54979537 missense probably damaging 1.00
IGL01092:Myh7 APN 14 54971632 missense possibly damaging 0.91
IGL01384:Myh7 APN 14 54971459 missense probably damaging 1.00
IGL01457:Myh7 APN 14 54988879 missense possibly damaging 0.66
IGL01671:Myh7 APN 14 54972924 missense probably damaging 1.00
IGL01923:Myh7 APN 14 54985459 critical splice donor site probably null
IGL02183:Myh7 APN 14 54974731 missense probably benign
IGL02379:Myh7 APN 14 54979468 missense probably damaging 1.00
IGL02884:Myh7 APN 14 54992819 missense probably benign 0.26
IGL02898:Myh7 APN 14 54983740 missense probably damaging 1.00
IGL03027:Myh7 APN 14 54983550 missense probably damaging 1.00
IGL03061:Myh7 APN 14 54991204 unclassified probably benign
IGL03145:Myh7 APN 14 54983345 missense probably damaging 1.00
IGL03250:Myh7 APN 14 54992247 missense probably damaging 1.00
IGL03394:Myh7 APN 14 54975361 missense probably damaging 1.00
R0019:Myh7 UTSW 14 54983734 missense possibly damaging 0.91
R0030:Myh7 UTSW 14 54991970 missense probably benign 0.00
R0183:Myh7 UTSW 14 54978876 missense probably benign 0.02
R0230:Myh7 UTSW 14 54973933 missense probably benign 0.03
R0295:Myh7 UTSW 14 54984821 splice site probably benign
R0423:Myh7 UTSW 14 54979189 missense probably benign 0.06
R0537:Myh7 UTSW 14 54990799 missense possibly damaging 0.81
R0541:Myh7 UTSW 14 54974701 missense probably benign
R0581:Myh7 UTSW 14 54985496 missense probably benign 0.02
R0786:Myh7 UTSW 14 54992873 start codon destroyed probably null
R0866:Myh7 UTSW 14 54973139 missense probably benign
R1068:Myh7 UTSW 14 54987319 missense possibly damaging 0.93
R1075:Myh7 UTSW 14 54987403 missense probably benign
R1124:Myh7 UTSW 14 54973870 missense possibly damaging 0.78
R1140:Myh7 UTSW 14 54972882 missense probably damaging 1.00
R1260:Myh7 UTSW 14 54988451 missense probably benign 0.00
R1653:Myh7 UTSW 14 54990789 missense probably benign 0.00
R1677:Myh7 UTSW 14 54987516 missense probably benign 0.17
R1760:Myh7 UTSW 14 54972713 missense probably damaging 1.00
R1838:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R1839:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R2483:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R2566:Myh7 UTSW 14 54983242 missense probably damaging 1.00
R3623:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R3916:Myh7 UTSW 14 54974046 missense probably damaging 0.97
R4236:Myh7 UTSW 14 54991118 missense probably benign 0.34
R4471:Myh7 UTSW 14 54991854 nonsense probably null
R4700:Myh7 UTSW 14 54988321 missense possibly damaging 0.85
R4805:Myh7 UTSW 14 54985133 missense probably benign 0.27
R4880:Myh7 UTSW 14 54978588 missense probably benign 0.18
R4975:Myh7 UTSW 14 54971671 missense probably damaging 1.00
R4982:Myh7 UTSW 14 54972767 missense probably damaging 0.98
R5004:Myh7 UTSW 14 54971683 missense probably damaging 0.99
R5107:Myh7 UTSW 14 54986424 intron probably benign
R5124:Myh7 UTSW 14 54985742 nonsense probably null
R5256:Myh7 UTSW 14 54979508 missense probably damaging 1.00
R5335:Myh7 UTSW 14 54986563 intron probably benign
R5581:Myh7 UTSW 14 54978954 missense probably benign 0.00
R5861:Myh7 UTSW 14 54988890 missense possibly damaging 0.89
R5957:Myh7 UTSW 14 54989078 missense probably damaging 1.00
R6027:Myh7 UTSW 14 54970802 missense probably benign 0.01
R6184:Myh7 UTSW 14 54988858 missense probably damaging 1.00
R6232:Myh7 UTSW 14 54989296 missense probably benign 0.00
R6268:Myh7 UTSW 14 54989284 missense probably benign 0.00
R6274:Myh7 UTSW 14 54979486 missense probably damaging 0.97
R6345:Myh7 UTSW 14 54983692 missense probably damaging 1.00
R6383:Myh7 UTSW 14 54988894 missense probably benign 0.00
R6641:Myh7 UTSW 14 54982280 missense probably benign 0.37
R6755:Myh7 UTSW 14 54992313 missense possibly damaging 0.71
R6952:Myh7 UTSW 14 54991740 missense probably damaging 1.00
R7025:Myh7 UTSW 14 54974644 nonsense probably null
R7257:Myh7 UTSW 14 54972490 intron probably null
R7296:Myh7 UTSW 14 54990025 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTCTCTATGTCTGCAGATGCCAAC -3'
(R):5'- TGCTGTTATTGCCGCCATTG -3'

Sequencing Primer
(F):5'- AACTTTCCTGTTGCCCCAAAATGG -3'
(R):5'- GGGACCGCAGCAAGAAG -3'
Posted On2019-06-26