Incidental Mutation 'R7201:Dsg1a'
ID560339
Institutional Source Beutler Lab
Gene Symbol Dsg1a
Ensembl Gene ENSMUSG00000069441
Gene Namedesmoglein 1 alpha
SynonymsDsg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7201 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20310811-20343350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20328311 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 253 (S253R)
Ref Sequence ENSEMBL: ENSMUSP00000076393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077146]
Predicted Effect probably damaging
Transcript: ENSMUST00000077146
AA Change: S253R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441
AA Change: S253R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 485 6.44e-1 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 590 598 N/A INTRINSIC
Pfam:Cadherin_C 659 781 1.6e-10 PFAM
low complexity region 786 799 N/A INTRINSIC
internal_repeat_1 823 888 9.56e-6 PROSPERO
internal_repeat_1 908 975 9.56e-6 PROSPERO
low complexity region 983 1004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,291,627 M1850V probably benign Het
4933406M09Rik A G 1: 134,390,468 D326G possibly damaging Het
Acaca A G 11: 84,262,474 T903A probably benign Het
Acin1 A T 14: 54,664,899 S479T possibly damaging Het
Actr6 A T 10: 89,712,512 D370E probably benign Het
Adgrl3 T C 5: 81,724,222 F921S probably damaging Het
Ankmy1 A T 1: 92,886,824 H320Q possibly damaging Het
Arhgef5 C T 6: 43,273,232 Q306* probably null Het
Arntl T A 7: 113,285,142 M122K probably damaging Het
Art4 A T 6: 136,854,549 V198E probably benign Het
Asph G A 4: 9,474,917 R686W probably damaging Het
Atg7 A G 6: 114,777,057 H724R probably damaging Het
B020004J07Rik T A 4: 101,838,141 probably null Het
BC034090 A G 1: 155,241,934 V146A probably damaging Het
Bcl2a1d T A 9: 88,731,586 Q45L probably damaging Het
Ccdc36 A T 9: 108,404,775 D571E probably damaging Het
Cd28 G T 1: 60,763,173 E84* probably null Het
Ceacam3 G A 7: 17,158,238 W302* probably null Het
Cerkl T C 2: 79,333,590 N462S probably benign Het
Cisd2 A T 3: 135,411,213 L39H probably damaging Het
Col11a1 C A 3: 114,090,157 T225K unknown Het
Col15a1 A T 4: 47,307,752 Y1178F possibly damaging Het
Cul4a T C 8: 13,142,991 S630P probably damaging Het
Cyp2c38 T A 19: 39,401,776 I327F probably damaging Het
Cyp3a25 A C 5: 145,991,447 S263A probably benign Het
Cyp3a25 T A 5: 146,003,058 L46F probably benign Het
D17Wsu92e A C 17: 27,794,070 probably null Het
Dmrta1 T A 4: 89,692,171 L456* probably null Het
Dnah12 T C 14: 26,814,622 L2165P probably benign Het
Egln2 A C 7: 27,160,319 I323S probably damaging Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fcgr2b G T 1: 170,963,397 Q276K probably benign Het
Fcrls C T 3: 87,252,627 C440Y probably damaging Het
Fmnl2 T C 2: 53,073,654 V266A unknown Het
Glo1 A T 17: 30,597,854 D109E probably benign Het
Grin3b A G 10: 79,974,078 R473G possibly damaging Het
Ica1 G A 6: 8,644,015 L425F probably damaging Het
Kcnq5 T C 1: 21,402,875 E716G possibly damaging Het
Klra17 A T 6: 129,873,343 I48K possibly damaging Het
Lrrc66 G T 5: 73,629,897 Q37K probably benign Het
Ly6a T A 15: 74,996,476 T55S probably benign Het
Lyst T A 13: 13,709,300 Y2924* probably null Het
Lyzl6 A G 11: 103,631,351 Y140H probably benign Het
Mak T C 13: 41,051,440 I141V possibly damaging Het
Mapk7 A G 11: 61,489,172 I789T probably benign Het
Mrpl4 T C 9: 21,007,338 I123T probably benign Het
Mup18 G C 4: 61,673,336 probably null Het
Myef2 T C 2: 125,096,162 probably null Het
Myh7 T C 14: 54,990,945 T235A possibly damaging Het
Myo18b C T 5: 112,715,459 C2171Y probably damaging Het
Nat8 A T 6: 85,830,895 Y85* probably null Het
Nyap1 A T 5: 137,736,262 S170T probably damaging Het
Ogfr AGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,094 probably benign Het
Olfr392 A G 11: 73,814,341 V247A probably benign Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr718-ps1 A G 5: 143,137,798 Y157H probably damaging Het
Papss1 T C 3: 131,599,926 L244P probably damaging Het
Pibf1 A T 14: 99,196,408 D597V probably damaging Het
Pmpcb T A 5: 21,737,179 M1K probably null Het
Ppwd1 G A 13: 104,207,172 P575L probably damaging Het
Prc1 A G 7: 80,311,089 Q457R possibly damaging Het
Prdm10 T C 9: 31,316,306 V69A possibly damaging Het
Prkdc A G 16: 15,698,803 I1014V probably benign Het
Rab3gap2 A G 1: 185,267,191 Y999C probably damaging Het
Robo3 G A 9: 37,424,330 Q539* probably null Het
Rps12 A G 10: 23,785,231 Y127H probably benign Het
Sar1b A G 11: 51,788,252 D116G probably benign Het
Selenbp2 C T 3: 94,702,357 P294L probably benign Het
Slc6a2 T C 8: 92,995,672 Y516H probably damaging Het
Slit2 A G 5: 48,237,285 N673S probably null Het
Snap91 A T 9: 86,790,146 probably null Het
Srpk2 A G 5: 23,507,628 F653L possibly damaging Het
Supt5 A T 7: 28,316,788 S824T probably benign Het
Taar7a A G 10: 23,992,460 V341A probably benign Het
Tmem52 G A 4: 155,470,321 G134R probably damaging Het
Ush2a A G 1: 188,874,754 T3949A probably benign Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 85,022,855 probably null Het
Vmn1r173 A T 7: 23,702,158 probably benign Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vwce A G 19: 10,638,115 E120G possibly damaging Het
Zfp143 T C 7: 110,093,080 V566A possibly damaging Het
Other mutations in Dsg1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Dsg1a APN 18 20340206 missense probably damaging 1.00
IGL01148:Dsg1a APN 18 20320925 missense probably damaging 0.97
IGL01534:Dsg1a APN 18 20340996 missense probably benign 0.06
IGL01566:Dsg1a APN 18 20336783 splice site probably benign
IGL01582:Dsg1a APN 18 20328848 missense probably null 1.00
IGL01913:Dsg1a APN 18 20322236 missense probably damaging 1.00
IGL01926:Dsg1a APN 18 20333584 missense possibly damaging 0.60
IGL02102:Dsg1a APN 18 20332032 missense probably benign 0.01
IGL02900:Dsg1a APN 18 20328656 splice site probably benign
IGL02937:Dsg1a APN 18 20331534 missense possibly damaging 0.93
IGL02962:Dsg1a APN 18 20340324 missense possibly damaging 0.92
IGL03003:Dsg1a APN 18 20336819 missense probably benign 0.43
PIT4687001:Dsg1a UTSW 18 20331698 missense probably benign 0.16
R0126:Dsg1a UTSW 18 20340878 missense probably benign 0.00
R0200:Dsg1a UTSW 18 20340938 missense probably benign 0.00
R0284:Dsg1a UTSW 18 20331627 missense probably damaging 0.98
R0394:Dsg1a UTSW 18 20333750 missense probably damaging 1.00
R0543:Dsg1a UTSW 18 20340863 missense probably damaging 1.00
R0656:Dsg1a UTSW 18 20335892 splice site probably benign
R0733:Dsg1a UTSW 18 20338668 missense probably damaging 0.97
R0750:Dsg1a UTSW 18 20340153 missense probably benign 0.10
R1300:Dsg1a UTSW 18 20332149 missense probably benign 0.19
R1501:Dsg1a UTSW 18 20332019 missense probably damaging 1.00
R1523:Dsg1a UTSW 18 20322317 missense probably damaging 0.99
R1673:Dsg1a UTSW 18 20331504 missense probably damaging 1.00
R1980:Dsg1a UTSW 18 20338650 missense probably damaging 1.00
R2102:Dsg1a UTSW 18 20333773 missense probably damaging 1.00
R2132:Dsg1a UTSW 18 20340797 missense probably damaging 1.00
R2299:Dsg1a UTSW 18 20340150 missense probably damaging 1.00
R2426:Dsg1a UTSW 18 20336804 missense probably damaging 0.96
R3031:Dsg1a UTSW 18 20340492 missense probably damaging 1.00
R4044:Dsg1a UTSW 18 20324030 missense probably damaging 1.00
R4075:Dsg1a UTSW 18 20340070 missense possibly damaging 0.53
R4644:Dsg1a UTSW 18 20340728 missense probably benign 0.04
R4661:Dsg1a UTSW 18 20340533 missense probably damaging 0.99
R4816:Dsg1a UTSW 18 20333722 missense probably benign 0.10
R5221:Dsg1a UTSW 18 20324014 missense possibly damaging 0.64
R5257:Dsg1a UTSW 18 20320931 missense probably damaging 1.00
R5360:Dsg1a UTSW 18 20340954 missense probably damaging 0.96
R5547:Dsg1a UTSW 18 20336040 critical splice donor site probably null
R5702:Dsg1a UTSW 18 20336865 critical splice donor site probably null
R5987:Dsg1a UTSW 18 20331542 missense probably damaging 1.00
R6108:Dsg1a UTSW 18 20340247 missense probably benign 0.19
R6170:Dsg1a UTSW 18 20335986 missense probably damaging 0.99
R7018:Dsg1a UTSW 18 20328738 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCGCTGGAAATGGATGCCAC -3'
(R):5'- TGTAGATAGCAAATACAGCAGGTGC -3'

Sequencing Primer
(F):5'- CCCATACTGAGTGATGTGAGATC -3'
(R):5'- GCACCTGCACACTGAATGAGTTC -3'
Posted On2019-06-26