Incidental Mutation 'R0592:Ppil2'
ID56038
Institutional Source Beutler Lab
Gene Symbol Ppil2
Ensembl Gene ENSMUSG00000022771
Gene Namepeptidylprolyl isomerase (cyclophilin)-like 2
Synonyms
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0592 (G1)
Quality Score209
Status Validated
Chromosome16
Chromosomal Location17086555-17111257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17107219 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 30 (S30P)
Ref Sequence ENSEMBL: ENSMUSP00000155861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023455] [ENSMUST00000115719] [ENSMUST00000115721] [ENSMUST00000164458] [ENSMUST00000231245] [ENSMUST00000231451] [ENSMUST00000231712] [ENSMUST00000232481]
Predicted Effect probably benign
Transcript: ENSMUST00000023455
AA Change: S30P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023455
Gene: ENSMUSG00000022771
AA Change: S30P

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115719
AA Change: S30P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111384
Gene: ENSMUSG00000022771
AA Change: S30P

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115721
AA Change: S30P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111386
Gene: ENSMUSG00000022771
AA Change: S30P

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 3.7e-53 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156521
Predicted Effect probably benign
Transcript: ENSMUST00000164458
AA Change: S30P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131422
Gene: ENSMUSG00000022771
AA Change: S30P

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231245
AA Change: S30P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231451
AA Change: S30P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231635
Predicted Effect probably benign
Transcript: ENSMUST00000231712
AA Change: S30P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232169
Predicted Effect probably benign
Transcript: ENSMUST00000232481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232510
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. This protein interacts with the proteinase inhibitor eglin c and is localized in the nucleus. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Ppil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ppil2 APN 16 17091212 missense probably damaging 1.00
IGL02392:Ppil2 APN 16 17088838 missense probably benign
IGL02559:Ppil2 APN 16 17109651 missense possibly damaging 0.80
IGL02708:Ppil2 APN 16 17106008 missense probably benign 0.03
IGL02724:Ppil2 APN 16 17103602 missense probably benign 0.08
zagnut UTSW 16 17096041 missense possibly damaging 0.62
R0975:Ppil2 UTSW 16 17107213 missense probably benign 0.00
R1258:Ppil2 UTSW 16 17106053 missense probably damaging 1.00
R1677:Ppil2 UTSW 16 17103610 missense probably damaging 1.00
R1728:Ppil2 UTSW 16 17089419 unclassified probably benign
R1739:Ppil2 UTSW 16 17089419 unclassified probably benign
R1784:Ppil2 UTSW 16 17089419 unclassified probably benign
R1853:Ppil2 UTSW 16 17107223 missense probably benign 0.00
R3608:Ppil2 UTSW 16 17092290 nonsense probably null
R3769:Ppil2 UTSW 16 17109668 missense probably benign 0.30
R4445:Ppil2 UTSW 16 17103600 nonsense probably null
R4518:Ppil2 UTSW 16 17096041 missense possibly damaging 0.62
R5066:Ppil2 UTSW 16 17109675 missense probably benign 0.03
R5842:Ppil2 UTSW 16 17094987 missense possibly damaging 0.66
R6013:Ppil2 UTSW 16 17100265 missense probably damaging 1.00
R6415:Ppil2 UTSW 16 17103574 critical splice donor site probably null
X0010:Ppil2 UTSW 16 17095037 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GCAAATATGCAAGgatggcagcctataa -3'
(R):5'- ccagtgAAGTACACTGAGCCACTGA -3'

Sequencing Primer
(F):5'- tggcagcctataatcctaatacttg -3'
(R):5'- ctgcctgcctctgcttc -3'
Posted On2013-07-11