Incidental Mutation 'R7202:Pcx'
ID560409
Institutional Source Beutler Lab
Gene Symbol Pcx
Ensembl Gene ENSMUSG00000024892
Gene Namepyruvate carboxylase
SynonymsPc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7202 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4510472-4621752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4602333 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 150 (M150L)
Ref Sequence ENSEMBL: ENSMUSP00000063825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068004] [ENSMUST00000113825] [ENSMUST00000224726] [ENSMUST00000225189]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068004
AA Change: M150L

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063825
Gene: ENSMUSG00000024892
AA Change: M150L

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:CPSase_L_chain 37 147 3.3e-45 PFAM
Pfam:ATP-grasp_4 149 334 3.9e-19 PFAM
Pfam:CPSase_L_D2 152 361 7.2e-77 PFAM
Pfam:Dala_Dala_lig_C 161 329 1.5e-11 PFAM
Biotin_carb_C 376 483 1.21e-50 SMART
low complexity region 513 541 N/A INTRINSIC
Pfam:HMGL-like 564 838 8.2e-29 PFAM
Pfam:PYC_OADA 862 1062 1.4e-72 PFAM
Pfam:Biotin_lipoyl 1111 1178 1.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113825
AA Change: M149L

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109456
Gene: ENSMUSG00000024892
AA Change: M149L

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:CPSase_L_chain 36 146 1.1e-43 PFAM
Pfam:ATP-grasp_4 148 332 2.9e-19 PFAM
Pfam:CPSase_L_D2 151 360 4.2e-77 PFAM
Pfam:Dala_Dala_lig_C 158 328 7.9e-13 PFAM
Biotin_carb_C 375 482 1.21e-50 SMART
low complexity region 512 540 N/A INTRINSIC
Pfam:HMGL-like 571 821 3.4e-28 PFAM
Pfam:PYC_OADA 861 1062 3.4e-69 PFAM
Pfam:Biotin_lipoyl 1110 1177 1.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000224726
AA Change: M149L

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000225189
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes pyruvate carboxylase, which requires biotin and ATP to catalyse the carboxylation of pyruvate to oxaloacetate. The active enzyme is a homotetramer arranged in a tetrahedron which is located exclusively in the mitochondrial matrix. Pyruvate carboxylase is involved in gluconeogenesis, lipogenesis, insulin secretion and synthesis of the neurotransmitter glutamate. Mutations in this gene have been associated with pyruvate carboxylase deficiency. Alternatively spliced transcript variants with different 5' UTRs, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,318,013 I1467T probably damaging Het
Adgrf3 T A 5: 30,204,380 K38* probably null Het
Ahdc1 T A 4: 133,061,887 C146* probably null Het
Ahnak A T 19: 9,017,799 K5482N probably damaging Het
AI464131 T C 4: 41,498,268 Y454C probably damaging Het
Arhgap23 C T 11: 97,451,993 A367V possibly damaging Het
Arvcf T C 16: 18,405,198 S960P probably damaging Het
Asb14 C A 14: 26,900,437 P74Q probably benign Het
Atad5 T C 11: 80,089,775 V2A probably damaging Het
Baz2a A G 10: 128,118,559 I691M possibly damaging Het
Brca2 A G 5: 150,532,354 T187A probably benign Het
Btbd11 A G 10: 85,387,765 E146G unknown Het
Calr4 T A 4: 109,244,057 N152K possibly damaging Het
Ccnb2 C T 9: 70,410,846 A215T probably damaging Het
Cdh16 C T 8: 104,614,148 D140N unknown Het
Ces1g T C 8: 93,302,967 T546A probably benign Het
Col5a1 G T 2: 27,952,378 D422Y unknown Het
Cyp2c66 A T 19: 39,141,904 Y61F probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah6 A G 6: 73,181,705 probably null Het
Fam163a A G 1: 156,079,088 F106L probably damaging Het
Gfy T C 7: 45,178,172 T167A probably benign Het
Gm6525 A T 3: 84,175,034 R87S probably benign Het
Gramd1c C A 16: 44,059,221 A19S possibly damaging Het
Herc2 T C 7: 56,131,286 V1233A probably damaging Het
Ibsp A T 5: 104,302,161 S9C probably benign Het
Il17ra A G 6: 120,475,611 I252V probably benign Het
Ino80 A T 2: 119,374,437 M1536K probably benign Het
Ipo11 A T 13: 106,875,570 L568Q probably damaging Het
Kdm5b T G 1: 134,624,759 S1158A probably benign Het
Kmt2a T C 9: 44,847,715 T946A probably benign Het
Krba1 G A 6: 48,412,327 V594M probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lig1 C T 7: 13,291,249 P227S probably benign Het
Lims2 T A 18: 31,956,964 D255E probably benign Het
Maats1 T C 16: 38,335,597 Y88C probably benign Het
March3 C T 18: 56,776,089 C208Y probably benign Het
Mei1 A G 15: 82,092,642 E142G Het
Melk G T 4: 44,351,106 R549L probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nae1 T C 8: 104,523,583 Y226C possibly damaging Het
Nap1l1 T C 10: 111,491,103 F175S probably damaging Het
Ndn T C 7: 62,348,961 L185P probably damaging Het
Ndst3 T A 3: 123,671,739 I195F possibly damaging Het
Ndufaf1 A T 2: 119,658,426 S206T probably benign Het
Nek10 C A 14: 14,836,171 H131N probably benign Het
Obsl1 T A 1: 75,489,716 D1456V possibly damaging Het
Olfr1328 C T 4: 118,934,018 V277I probably benign Het
Olfr605 T A 7: 103,443,085 T13S probably benign Het
Olfr714 A G 7: 107,074,241 N138D probably benign Het
Otog C T 7: 46,288,050 L1728F probably damaging Het
Pole A G 5: 110,297,107 D443G possibly damaging Het
Prr14 G T 7: 127,476,476 R552L probably damaging Het
Rasgrf1 T G 9: 90,017,072 S1156A possibly damaging Het
Rfc4 T A 16: 23,127,609 probably benign Het
Rfx5 G T 3: 94,958,961 A524S unknown Het
Ryr3 G A 2: 112,766,319 P2497S probably damaging Het
Scg3 T C 9: 75,683,710 T6A probably benign Het
Slc26a9 A T 1: 131,762,788 D510V possibly damaging Het
Stpg3 A G 2: 25,214,574 F10L probably damaging Het
Tmc5 T A 7: 118,639,956 H357Q possibly damaging Het
Tmem40 A T 6: 115,730,459 L253H probably damaging Het
Tmie A G 9: 110,867,564 V83A probably damaging Het
Uck2 A T 1: 167,226,515 I218N probably damaging Het
Vtn A G 11: 78,500,800 D310G possibly damaging Het
Wdr49 A T 3: 75,333,273 S430T probably benign Het
Wtip A G 7: 34,132,662 V133A probably benign Het
Zbtb9 T A 17: 26,974,692 V357E probably damaging Het
Zfp953 G A 13: 67,343,642 T82M probably benign Het
Other mutations in Pcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Pcx APN 19 4620937 missense probably benign 0.02
IGL01339:Pcx APN 19 4620235 unclassified probably null
IGL01373:Pcx APN 19 4620235 unclassified probably null
IGL01704:Pcx APN 19 4621060 missense probably damaging 1.00
IGL02223:Pcx APN 19 4601978 missense probably damaging 1.00
PIT4151001:Pcx UTSW 19 4603129 missense probably damaging 1.00
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0398:Pcx UTSW 19 4601610 missense probably benign 0.35
R0414:Pcx UTSW 19 4607642 missense possibly damaging 0.60
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1479:Pcx UTSW 19 4602024 missense probably damaging 1.00
R1543:Pcx UTSW 19 4602223 missense probably damaging 1.00
R1559:Pcx UTSW 19 4619086 missense probably damaging 1.00
R1607:Pcx UTSW 19 4603159 missense possibly damaging 0.89
R1833:Pcx UTSW 19 4619104 missense probably damaging 0.98
R1866:Pcx UTSW 19 4621221 missense possibly damaging 0.58
R2131:Pcx UTSW 19 4602551 missense probably benign 0.00
R2172:Pcx UTSW 19 4620881 missense probably benign 0.17
R2224:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2226:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2280:Pcx UTSW 19 4604543 missense probably damaging 1.00
R3950:Pcx UTSW 19 4617967 missense probably benign 0.00
R3952:Pcx UTSW 19 4617967 missense probably benign 0.00
R4205:Pcx UTSW 19 4619166 missense possibly damaging 0.95
R4409:Pcx UTSW 19 4610003 missense possibly damaging 0.65
R4670:Pcx UTSW 19 4619888 missense probably damaging 1.00
R4691:Pcx UTSW 19 4619477 missense probably damaging 0.99
R4728:Pcx UTSW 19 4603096 missense probably damaging 1.00
R4808:Pcx UTSW 19 4620928 missense probably benign 0.00
R5200:Pcx UTSW 19 4618504 missense probably damaging 1.00
R5454:Pcx UTSW 19 4602476 missense probably damaging 1.00
R5621:Pcx UTSW 19 4619167 missense possibly damaging 0.59
R5990:Pcx UTSW 19 4621266 missense probably damaging 1.00
R6519:Pcx UTSW 19 4602211 missense possibly damaging 0.64
R6526:Pcx UTSW 19 4604495 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ACCAGCAGAATCTGTGAACAAG -3'
(R):5'- TTGGAGAACTCATGCGCCTC -3'

Sequencing Primer
(F):5'- TGAGAGTAGATCCCAGCAAGG -3'
(R):5'- CTCGTGCAGGGAGCTGATG -3'
Posted On2019-06-26