Incidental Mutation 'R7204:Adam15'
ID560426
Institutional Source Beutler Lab
Gene Symbol Adam15
Ensembl Gene ENSMUSG00000028041
Gene Namea disintegrin and metallopeptidase domain 15 (metargidin)
SynonymsMDC15, metargidin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R7204 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89338542-89349996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89346937 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 184 (H184Q)
Ref Sequence ENSEMBL: ENSMUSP00000029676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029676] [ENSMUST00000070820] [ENSMUST00000074582] [ENSMUST00000107446] [ENSMUST00000107448] [ENSMUST00000184651]
Predicted Effect probably benign
Transcript: ENSMUST00000029676
AA Change: H184Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029676
Gene: ENSMUSG00000028041
AA Change: H184Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 158 1.2e-14 PFAM
Pfam:Reprolysin_3 208 360 1e-12 PFAM
Pfam:Reprolysin_5 212 394 1.5e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 416 1.6e-54 PFAM
Pfam:Reprolysin_2 257 405 9.9e-12 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070820
SMART Domains Protein: ENSMUSP00000065502
Gene: ENSMUSG00000042672

DomainStartEndE-ValueType
coiled coil region 18 44 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 108 125 N/A INTRINSIC
transmembrane domain 398 420 N/A INTRINSIC
Pfam:DC_STAMP 431 621 1.5e-55 PFAM
Blast:RING 672 710 3e-17 BLAST
SCOP:d1ldjb_ 672 710 2e-3 SMART
low complexity region 717 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074582
AA Change: H184Q

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074167
Gene: ENSMUSG00000028041
AA Change: H184Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.6e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 2.9e-8 PFAM
Pfam:Reprolysin 214 415 4.2e-56 PFAM
Pfam:Reprolysin_3 238 360 1.7e-14 PFAM
Pfam:Reprolysin_2 254 405 1.1e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 760 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107446
AA Change: H184Q

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103070
Gene: ENSMUSG00000028041
AA Change: H184Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 9.9e-22 PFAM
Pfam:Reprolysin_3 209 360 5.9e-15 PFAM
Pfam:Reprolysin_5 212 394 5e-16 PFAM
Pfam:Reprolysin_4 213 410 1e-8 PFAM
Pfam:Reprolysin 214 415 1.4e-56 PFAM
Pfam:Reprolysin_2 253 405 4e-11 PFAM
low complexity region 416 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107448
AA Change: H184Q

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103072
Gene: ENSMUSG00000028041
AA Change: H184Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.7e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 3e-8 PFAM
Pfam:Reprolysin 214 415 4.4e-56 PFAM
Pfam:Reprolysin_3 238 360 1.8e-14 PFAM
Pfam:Reprolysin_2 254 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 783 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184651
AA Change: H184Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139147
Gene: ENSMUSG00000028041
AA Change: H184Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.9e-21 PFAM
Pfam:Reprolysin_5 212 394 1.7e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 415 4.6e-56 PFAM
Pfam:Reprolysin_3 238 360 1.9e-14 PFAM
Pfam:Reprolysin_2 255 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is prominently expressed in vascular cells, the endocardium, hypertrophic cells in developing bone, and specific areas of hippocampus and cerebellum. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein have increased bone mass resulting from osteoblast proliferation, and exhibit reduced neovascularization in a mouse model for retinopathy. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice develop normally and exhibit normal angiogenesis, but show a resistance to pathological neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,004,007 S227P probably damaging Het
4930444G20Rik A G 10: 22,067,886 L65P probably damaging Het
9130019O22Rik A T 7: 127,384,346 I528K possibly damaging Het
Acot6 A G 12: 84,106,527 H181R probably benign Het
Agl A G 3: 116,793,820 F29L probably benign Het
Ak7 A G 12: 105,742,243 Y319C probably benign Het
Ano8 C A 8: 71,479,025 V813L probably benign Het
Apbb2 T G 5: 66,451,603 K234Q probably damaging Het
Arfgef3 A T 10: 18,646,462 D605E probably damaging Het
Bfsp2 C A 9: 103,432,666 R340L probably damaging Het
Birc6 C A 17: 74,640,108 P2956T probably damaging Het
C1rb T C 6: 124,577,427 I389T probably benign Het
Ccdc146 A G 5: 21,308,626 F498S probably benign Het
Cdc14b A C 13: 64,210,198 V361G possibly damaging Het
Cdc25b A T 2: 131,191,632 I164F probably damaging Het
Col18a1 A G 10: 77,085,276 S297P unknown Het
Col3a1 A T 1: 45,322,418 I117F unknown Het
Cox4i2 AG A 2: 152,760,698 probably null Het
Crybg3 C A 16: 59,558,890 G667V probably benign Het
Ctc1 A G 11: 69,029,741 D623G probably damaging Het
Dennd1a A T 2: 38,039,203 H152Q probably damaging Het
Dgke G A 11: 89,041,480 P495S probably damaging Het
Dll3 A T 7: 28,298,905 C212S possibly damaging Het
Dll4 A T 2: 119,328,573 S235C probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 A T 14: 26,781,485 T1599S probably damaging Het
Elavl1 G A 8: 4,311,712 T20M probably damaging Het
Epha3 T C 16: 63,652,332 T397A probably benign Het
Fanca A T 8: 123,286,477 I859N probably damaging Het
Fzd1 A T 5: 4,755,980 V534D probably damaging Het
Glmp A G 3: 88,326,610 Y258C probably damaging Het
Gm9195 G A 14: 72,474,186 P329S probably damaging Het
Gm9573 AGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCAGTGCTGGATACAGTGGTGGTC AGCTGGATACAGTGGTGGTC 17: 35,621,213 probably benign Het
Gpt A G 15: 76,698,999 R379G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Hemgn T C 4: 46,397,054 K61E possibly damaging Het
Ikzf4 A T 10: 128,643,890 S56T possibly damaging Het
Jak1 T C 4: 101,175,135 T425A probably benign Het
Jsrp1 T C 10: 80,810,485 T80A probably benign Het
Klra9 T A 6: 130,188,680 D124V possibly damaging Het
Lama5 A T 2: 180,202,177 V397D probably damaging Het
Lrp2 A G 2: 69,472,533 S2951P probably benign Het
Map7d1 A G 4: 126,256,015 probably null Het
Mcm6 A T 1: 128,338,127 C636S probably damaging Het
Mia T C 7: 27,180,933 E39G possibly damaging Het
Mpeg1 T A 19: 12,462,894 I572N probably damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mup5 A G 4: 61,833,755 Y86H probably damaging Het
Nckap5 A T 1: 126,026,367 V816D probably benign Het
Nfib T C 4: 82,296,815 probably null Het
Nlrc5 T A 8: 94,491,525 V1056D possibly damaging Het
Nynrin G C 14: 55,872,733 E1766Q probably damaging Het
Olfr39 A T 9: 20,285,804 Y43F probably benign Het
Oxct1 T A 15: 4,094,042 L328Q probably damaging Het
Pax5 T A 4: 44,679,485 I187F possibly damaging Het
Pcdhb4 A T 18: 37,309,239 D534V probably damaging Het
Pebp4 C T 14: 69,847,597 P35S probably benign Het
Pkhd1l1 T A 15: 44,523,553 V1274E possibly damaging Het
Plcz1 A T 6: 140,010,424 V373D probably benign Het
Plxnb1 C T 9: 109,100,175 T33I probably damaging Het
Prag1 T C 8: 36,146,761 C1156R probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbp4 G A 19: 38,124,103 T138I possibly damaging Het
Slc12a1 A T 2: 125,200,622 N733Y possibly damaging Het
Slc27a3 A G 3: 90,389,726 V22A probably benign Het
Tcaf1 T C 6: 42,675,039 probably null Het
Tnc T C 4: 63,971,155 probably null Het
Tspan31 A T 10: 127,068,118 *211R probably null Het
Ttc17 A T 2: 94,362,428 V86D possibly damaging Het
Ubr1 T A 2: 120,904,077 N1114I possibly damaging Het
Ulk2 C T 11: 61,783,631 G850R probably benign Het
Vmn1r13 T A 6: 57,210,156 I100N probably benign Het
Zan T C 5: 137,427,978 D2512G unknown Het
Zc3h14 A T 12: 98,771,356 N34I probably damaging Het
Zcwpw1 T G 5: 137,812,084 L374R probably damaging Het
Other mutations in Adam15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Adam15 APN 3 89344138 missense probably benign 0.03
IGL01994:Adam15 APN 3 89341505 splice site probably benign
IGL02184:Adam15 APN 3 89345934 splice site probably benign
IGL02501:Adam15 APN 3 89340462 missense possibly damaging 0.82
IGL02821:Adam15 APN 3 89345356 missense probably damaging 1.00
IGL02933:Adam15 APN 3 89343483 missense possibly damaging 0.91
IGL03078:Adam15 APN 3 89345937 splice site probably benign
IGL03185:Adam15 APN 3 89347905 missense probably benign 0.41
PIT4280001:Adam15 UTSW 3 89343978 critical splice acceptor site probably null
PIT4581001:Adam15 UTSW 3 89343832 missense probably benign 0.00
R0559:Adam15 UTSW 3 89343778 missense probably damaging 1.00
R1530:Adam15 UTSW 3 89349830 missense probably damaging 0.99
R1670:Adam15 UTSW 3 89348510 splice site probably benign
R1909:Adam15 UTSW 3 89345330 missense probably benign 0.19
R3110:Adam15 UTSW 3 89347457 missense probably benign 0.10
R3112:Adam15 UTSW 3 89347457 missense probably benign 0.10
R3897:Adam15 UTSW 3 89346938 missense probably benign 0.00
R4058:Adam15 UTSW 3 89347055 missense possibly damaging 0.94
R4573:Adam15 UTSW 3 89345986 missense probably damaging 1.00
R5267:Adam15 UTSW 3 89349899 utr 5 prime probably benign
R5364:Adam15 UTSW 3 89345595 missense probably damaging 1.00
R5801:Adam15 UTSW 3 89342361 missense probably damaging 1.00
R5813:Adam15 UTSW 3 89345828 missense probably benign 0.12
R5964:Adam15 UTSW 3 89343567 nonsense probably null
R6218:Adam15 UTSW 3 89343883 missense probably benign 0.00
R6564:Adam15 UTSW 3 89347212 missense possibly damaging 0.56
R6579:Adam15 UTSW 3 89345629 missense probably damaging 1.00
R6834:Adam15 UTSW 3 89340083 missense probably damaging 0.96
R7131:Adam15 UTSW 3 89346980 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ATAGAGCTTTGGGCAGCACC -3'
(R):5'- TACCAGGGAAGAGGATCCACAC -3'

Sequencing Primer
(F):5'- CCTTCTCGGGTTGCTAGGAATAGC -3'
(R):5'- ATCCACACAGGCAGGGAGC -3'
Posted On2019-06-26