Incidental Mutation 'R7204:Zc3h14'
ID560466
Institutional Source Beutler Lab
Gene Symbol Zc3h14
Ensembl Gene ENSMUSG00000021012
Gene Namezinc finger CCCH type containing 14
Synonyms1700016A15Rik, 1010001P15Rik, 2700069A02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7204 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location98746964-98787753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98771356 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 34 (N34I)
Ref Sequence ENSEMBL: ENSMUSP00000021399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021399] [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532]
Predicted Effect probably damaging
Transcript: ENSMUST00000021399
AA Change: N34I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021399
Gene: ENSMUSG00000021012
AA Change: N34I

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 69 91 N/A INTRINSIC
ZnF_C3H1 170 193 7.16e-1 SMART
ZnF_C3H1 195 214 5.27e1 SMART
ZnF_C3H1 250 272 5.55e0 SMART
Pfam:zf-CCCH_2 273 290 1.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057000
SMART Domains Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 440 463 7.16e-1 SMART
ZnF_C3H1 465 484 5.27e1 SMART
ZnF_C3H1 520 542 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110104
SMART Domains Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 465 488 7.16e-1 SMART
ZnF_C3H1 490 509 5.27e1 SMART
ZnF_C3H1 545 567 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110105
SMART Domains Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 596 619 7.16e-1 SMART
ZnF_C3H1 621 640 5.27e1 SMART
ZnF_C3H1 676 698 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221532
Predicted Effect probably benign
Transcript: ENSMUST00000223451
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,004,007 S227P probably damaging Het
4930444G20Rik A G 10: 22,067,886 L65P probably damaging Het
9130019O22Rik A T 7: 127,384,346 I528K possibly damaging Het
Acot6 A G 12: 84,106,527 H181R probably benign Het
Adam15 A T 3: 89,346,937 H184Q probably benign Het
Agl A G 3: 116,793,820 F29L probably benign Het
Ak7 A G 12: 105,742,243 Y319C probably benign Het
Ano8 C A 8: 71,479,025 V813L probably benign Het
Apbb2 T G 5: 66,451,603 K234Q probably damaging Het
Arfgef3 A T 10: 18,646,462 D605E probably damaging Het
Bfsp2 C A 9: 103,432,666 R340L probably damaging Het
Birc6 C A 17: 74,640,108 P2956T probably damaging Het
C1rb T C 6: 124,577,427 I389T probably benign Het
Ccdc146 A G 5: 21,308,626 F498S probably benign Het
Cdc14b A C 13: 64,210,198 V361G possibly damaging Het
Cdc25b A T 2: 131,191,632 I164F probably damaging Het
Col18a1 A G 10: 77,085,276 S297P unknown Het
Col3a1 A T 1: 45,322,418 I117F unknown Het
Cox4i2 AG A 2: 152,760,698 probably null Het
Crybg3 C A 16: 59,558,890 G667V probably benign Het
Ctc1 A G 11: 69,029,741 D623G probably damaging Het
Dennd1a A T 2: 38,039,203 H152Q probably damaging Het
Dgke G A 11: 89,041,480 P495S probably damaging Het
Dll3 A T 7: 28,298,905 C212S possibly damaging Het
Dll4 A T 2: 119,328,573 S235C probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 A T 14: 26,781,485 T1599S probably damaging Het
Elavl1 G A 8: 4,311,712 T20M probably damaging Het
Epha3 T C 16: 63,652,332 T397A probably benign Het
Fanca A T 8: 123,286,477 I859N probably damaging Het
Fzd1 A T 5: 4,755,980 V534D probably damaging Het
Glmp A G 3: 88,326,610 Y258C probably damaging Het
Gm9195 G A 14: 72,474,186 P329S probably damaging Het
Gm9573 AGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCAGTGCTGGATACAGTGGTGGTC AGCTGGATACAGTGGTGGTC 17: 35,621,213 probably benign Het
Gpt A G 15: 76,698,999 R379G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Hemgn T C 4: 46,397,054 K61E possibly damaging Het
Ikzf4 A T 10: 128,643,890 S56T possibly damaging Het
Jak1 T C 4: 101,175,135 T425A probably benign Het
Jsrp1 T C 10: 80,810,485 T80A probably benign Het
Klra9 T A 6: 130,188,680 D124V possibly damaging Het
Lama5 A T 2: 180,202,177 V397D probably damaging Het
Lrp2 A G 2: 69,472,533 S2951P probably benign Het
Map7d1 A G 4: 126,256,015 probably null Het
Mcm6 A T 1: 128,338,127 C636S probably damaging Het
Mia T C 7: 27,180,933 E39G possibly damaging Het
Mpeg1 T A 19: 12,462,894 I572N probably damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mup5 A G 4: 61,833,755 Y86H probably damaging Het
Nckap5 A T 1: 126,026,367 V816D probably benign Het
Nlrc5 T A 8: 94,491,525 V1056D possibly damaging Het
Nynrin G C 14: 55,872,733 E1766Q probably damaging Het
Olfr39 A T 9: 20,285,804 Y43F probably benign Het
Oxct1 T A 15: 4,094,042 L328Q probably damaging Het
Pax5 T A 4: 44,679,485 I187F possibly damaging Het
Pcdhb4 A T 18: 37,309,239 D534V probably damaging Het
Pebp4 C T 14: 69,847,597 P35S probably benign Het
Pkhd1l1 T A 15: 44,523,553 V1274E possibly damaging Het
Plcz1 A T 6: 140,010,424 V373D probably benign Het
Plxnb1 C T 9: 109,100,175 T33I probably damaging Het
Prag1 T C 8: 36,146,761 C1156R probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbp4 G A 19: 38,124,103 T138I possibly damaging Het
Slc12a1 A T 2: 125,200,622 N733Y possibly damaging Het
Slc27a3 A G 3: 90,389,726 V22A probably benign Het
Tspan31 A T 10: 127,068,118 *211R probably null Het
Ttc17 A T 2: 94,362,428 V86D possibly damaging Het
Ubr1 T A 2: 120,904,077 N1114I possibly damaging Het
Ulk2 C T 11: 61,783,631 G850R probably benign Het
Vmn1r13 T A 6: 57,210,156 I100N probably benign Het
Zan T C 5: 137,427,978 D2512G unknown Het
Zcwpw1 T G 5: 137,812,084 L374R probably damaging Het
Other mutations in Zc3h14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Zc3h14 APN 12 98747524 critical splice donor site probably null
IGL00946:Zc3h14 APN 12 98759883 splice site probably benign
IGL00969:Zc3h14 APN 12 98758843 missense probably benign 0.00
IGL01626:Zc3h14 APN 12 98779186 missense possibly damaging 0.72
IGL01891:Zc3h14 APN 12 98758947 unclassified probably benign
IGL02119:Zc3h14 APN 12 98763895 missense probably benign 0.00
IGL02484:Zc3h14 APN 12 98774301 missense probably benign 0.14
IGL02744:Zc3h14 APN 12 98784975 missense possibly damaging 0.67
IGL02894:Zc3h14 APN 12 98758943 critical splice donor site probably null
R0408:Zc3h14 UTSW 12 98763823 missense probably damaging 1.00
R0739:Zc3h14 UTSW 12 98757201 missense probably damaging 0.99
R0865:Zc3h14 UTSW 12 98779269 critical splice donor site probably null
R0926:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R1530:Zc3h14 UTSW 12 98785003 missense probably damaging 1.00
R1735:Zc3h14 UTSW 12 98758580 missense probably damaging 1.00
R1743:Zc3h14 UTSW 12 98779189 missense probably benign 0.04
R1848:Zc3h14 UTSW 12 98752832 missense possibly damaging 0.89
R1851:Zc3h14 UTSW 12 98760354 nonsense probably null
R1978:Zc3h14 UTSW 12 98763922 missense probably damaging 0.97
R2011:Zc3h14 UTSW 12 98780268 missense possibly damaging 0.76
R2198:Zc3h14 UTSW 12 98752809 missense probably damaging 1.00
R2198:Zc3h14 UTSW 12 98752810 missense possibly damaging 0.94
R2263:Zc3h14 UTSW 12 98758514 missense probably benign 0.32
R3762:Zc3h14 UTSW 12 98758643 missense probably damaging 1.00
R4210:Zc3h14 UTSW 12 98785399 missense probably damaging 1.00
R4353:Zc3h14 UTSW 12 98763960 missense possibly damaging 0.70
R4360:Zc3h14 UTSW 12 98780197 missense probably benign 0.09
R4814:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4815:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4817:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4947:Zc3h14 UTSW 12 98759824 missense probably benign
R5077:Zc3h14 UTSW 12 98757206 critical splice donor site probably null
R5431:Zc3h14 UTSW 12 98780065 missense possibly damaging 0.94
R5783:Zc3h14 UTSW 12 98757175 missense probably damaging 0.99
R5850:Zc3h14 UTSW 12 98779155 missense probably damaging 0.97
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6291:Zc3h14 UTSW 12 98759828 missense probably damaging 1.00
R6338:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R6595:Zc3h14 UTSW 12 98757026 missense probably damaging 0.98
R6737:Zc3h14 UTSW 12 98785046 missense probably damaging 1.00
R6932:Zc3h14 UTSW 12 98771077 intron probably benign
R7074:Zc3h14 UTSW 12 98758600 missense possibly damaging 0.96
R7237:Zc3h14 UTSW 12 98780149 missense probably benign 0.34
R7267:Zc3h14 UTSW 12 98785729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGTTGTAGGTCACTAGCACTC -3'
(R):5'- GTCTCTCTTGAAAATCTTCCAACTG -3'

Sequencing Primer
(F):5'- GTTGTAGGTCACTAGCACTCTAAAG -3'
(R):5'- AACTGTCTGTTGCATTCAGATG -3'
Posted On2019-06-26