Incidental Mutation 'R7205:Trrap'
ID560509
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Nametransformation/transcription domain-associated protein
Synonymstransactivation/transformation-domain associated protein
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7205 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location144767732-144859778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144842707 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 3161 (N3161I)
Ref Sequence ENSEMBL: ENSMUSP00000098035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038980
AA Change: N3161I

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: N3161I

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094120
AA Change: N3190I

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: N3190I

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100467
AA Change: N3161I

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: N3161I

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: N2900I

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213013
AA Change: N3191I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,289,327 D2616E probably benign Het
5430419D17Rik T C 7: 131,277,623 probably null Het
Abca15 A T 7: 120,394,364 K1269M possibly damaging Het
Adgrl2 A T 3: 148,858,949 Y332N probably damaging Het
Adgrv1 C T 13: 81,479,658 V3695I probably benign Het
Aldh1l1 A T 6: 90,598,275 Y848F probably damaging Het
Ambra1 T C 2: 91,767,758 V88A possibly damaging Het
Ankrd12 C T 17: 65,985,165 R1091Q probably damaging Het
Apob T G 12: 8,005,087 V1362G probably damaging Het
Arhgap17 A G 7: 123,306,438 L328P probably damaging Het
Arhgap27 A C 11: 103,344,541 V9G probably benign Het
Arhgap33 A T 7: 30,533,009 D34E probably damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Atf6b T C 17: 34,653,729 Y575H probably damaging Het
BC100530 T C 16: 36,367,447 I19V probably benign Het
Bcl2l2 T G 14: 54,884,601 S74A probably benign Het
Begain T C 12: 109,038,868 T73A possibly damaging Het
Bicdl1 C T 5: 115,670,281 R264Q probably damaging Het
Ccdc180 A G 4: 45,914,588 D701G probably benign Het
Cd200r4 G T 16: 44,833,166 V146L probably damaging Het
Cd226 G A 18: 89,247,198 C200Y probably damaging Het
Cdk12 A G 11: 98,224,625 N864S unknown Het
Clcnkb A T 4: 141,408,635 L413Q probably damaging Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Cnn1 T A 9: 22,105,782 probably null Het
Cpa5 C A 6: 30,630,830 Q364K probably benign Het
Ddx11 A G 17: 66,130,771 E164G probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Drc7 T A 8: 95,077,921 Y855N probably damaging Het
Fam20b C A 1: 156,702,398 probably null Het
Flt4 A G 11: 49,634,298 D657G probably null Het
Fmo3 T A 1: 162,954,288 T499S possibly damaging Het
Fyco1 C T 9: 123,822,426 G1190S probably benign Het
Galnt17 C A 5: 131,306,752 probably benign Het
Ggcx T C 6: 72,428,004 I465T probably damaging Het
Gm11238 A G 4: 73,654,920 Y132C probably damaging Het
Gm281 T C 14: 13,866,032 T286A Het
Gm4788 A T 1: 139,753,050 Y243* probably null Het
Gm7361 T A 5: 26,261,118 N159K probably damaging Het
Golgb1 A G 16: 36,875,301 N54S unknown Het
Grin2c G A 11: 115,251,050 P848S probably damaging Het
Grina T C 15: 76,249,087 V285A probably damaging Het
Gtpbp6 A G 5: 110,104,612 L381P probably damaging Het
Herc2 G T 7: 56,182,640 G3028V probably damaging Het
Ibsp A T 5: 104,310,431 Y278F probably damaging Het
Ints4 T A 7: 97,535,226 L846* probably null Het
Kif17 A G 4: 138,293,766 K849E probably benign Het
Krt77 G A 15: 101,869,371 P83L probably benign Het
Ky T G 9: 102,542,292 D499E probably damaging Het
Lrp3 A T 7: 35,202,626 M610K probably damaging Het
Lrrfip1 T A 1: 91,091,616 D156E probably benign Het
Map6 C A 7: 99,269,050 H343Q probably benign Het
Micu2 G T 14: 57,954,149 D148E probably benign Het
Mks1 T A 11: 87,856,602 S153T probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myh9 T C 15: 77,783,472 K587R probably benign Het
Neb T C 2: 52,196,356 Y5478C probably damaging Het
Nps T A 7: 135,268,781 L11I probably damaging Het
Nsd1 A T 13: 55,246,470 D731V probably damaging Het
Nup50 A G 15: 84,933,658 T93A probably benign Het
Nup98 A T 7: 102,195,041 F29Y unknown Het
Olfr1195 T C 2: 88,683,423 H103R possibly damaging Het
Olfr1414 A T 1: 92,511,851 M59K probably benign Het
Olfr212 A G 6: 116,515,975 Y66C probably damaging Het
Olfr469 T C 7: 107,822,575 N298S probably benign Het
Oprd1 A G 4: 132,113,801 I282T probably damaging Het
Osbp2 T C 11: 3,712,134 I240V probably damaging Het
Otub2 C A 12: 103,392,904 P84Q probably benign Het
Parp9 A T 16: 35,956,990 I435F probably benign Het
Pcdh18 C T 3: 49,755,474 R464H probably benign Het
Pcsk6 G T 7: 66,025,408 probably null Het
Ptgs2 G A 1: 150,102,761 R208Q probably benign Het
Rab11b G A 17: 33,749,867 R51C probably damaging Het
Rad1 A G 15: 10,493,257 I257V probably benign Het
Rbms3 C T 9: 116,586,017 probably null Het
Rxfp2 A T 5: 150,059,899 I300L probably benign Het
Rxfp2 C A 5: 150,059,903 T301K probably benign Het
Sars2 G T 7: 28,744,308 A112S probably benign Het
Scn10a T C 9: 119,613,550 D1543G probably damaging Het
Serpinb1b A G 13: 33,087,423 H59R probably benign Het
Sgsm2 T A 11: 74,854,493 D661V possibly damaging Het
Smad6 C A 9: 64,020,406 V207L probably damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Tenm2 C T 11: 36,049,129 R1390Q probably damaging Het
Tmem132a T A 19: 10,866,931 Q101L probably damaging Het
Tmem151a A G 19: 5,082,773 V135A probably damaging Het
Trappc10 T C 10: 78,210,428 K443E probably damaging Het
Tspan32 G T 7: 143,005,126 R6L possibly damaging Het
Ugt2a2 T C 5: 87,460,609 D457G possibly damaging Het
Ulk2 A T 11: 61,834,831 S140T possibly damaging Het
Upf1 C T 8: 70,340,045 A338T possibly damaging Het
Usp43 C T 11: 67,883,284 R460Q probably null Het
Vmn1r59 A G 7: 5,454,726 C12R probably damaging Het
Wdr64 A G 1: 175,789,933 D693G probably benign Het
Wnt2 G T 6: 18,028,047 R63S probably benign Het
Zcchc6 C G 13: 59,788,550 D1246H probably damaging Het
Zfp418 A T 7: 7,181,563 Q175L probably benign Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144779974 splice site probably benign
IGL00470:Trrap APN 5 144818038 missense probably damaging 1.00
IGL00490:Trrap APN 5 144825225 missense probably benign 0.40
IGL01072:Trrap APN 5 144784255 splice site probably benign
IGL01087:Trrap APN 5 144846539 missense probably damaging 0.99
IGL01300:Trrap APN 5 144804818 missense probably damaging 1.00
IGL01350:Trrap APN 5 144830969 missense possibly damaging 0.92
IGL01410:Trrap APN 5 144831021 missense probably benign 0.00
IGL01571:Trrap APN 5 144833287 splice site probably benign
IGL01748:Trrap APN 5 144833340 missense probably damaging 1.00
IGL01839:Trrap APN 5 144821875 missense probably damaging 1.00
IGL01976:Trrap APN 5 144856989 missense probably benign 0.00
IGL02075:Trrap APN 5 144828494 missense probably benign 0.00
IGL02127:Trrap APN 5 144816433 missense probably benign 0.22
IGL02131:Trrap APN 5 144840436 missense probably damaging 1.00
IGL02287:Trrap APN 5 144832538 missense probably damaging 1.00
IGL02301:Trrap APN 5 144777917 missense probably benign 0.05
IGL02336:Trrap APN 5 144798390 missense probably benign 0.39
IGL02526:Trrap APN 5 144824550 missense probably benign 0.00
IGL02873:Trrap APN 5 144841079 splice site probably benign
IGL02953:Trrap APN 5 144815964 missense probably damaging 0.99
IGL03404:Trrap APN 5 144833186 missense probably benign 0.00
Card-tower UTSW 5 144804766 missense probably damaging 1.00
PIT4243001:Trrap UTSW 5 144796971 missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144828600 missense probably benign 0.02
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0112:Trrap UTSW 5 144822761 nonsense probably null
R0126:Trrap UTSW 5 144805750 nonsense probably null
R0257:Trrap UTSW 5 144804235 missense probably benign 0.31
R0325:Trrap UTSW 5 144816395 missense probably benign 0.05
R0376:Trrap UTSW 5 144816339 missense probably benign 0.03
R0396:Trrap UTSW 5 144814556 missense probably damaging 0.99
R0448:Trrap UTSW 5 144839567 missense possibly damaging 0.66
R0454:Trrap UTSW 5 144846477 missense probably damaging 1.00
R0711:Trrap UTSW 5 144853499 missense probably damaging 1.00
R0827:Trrap UTSW 5 144814830 missense probably benign 0.00
R1005:Trrap UTSW 5 144805727 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1179:Trrap UTSW 5 144777939 missense possibly damaging 0.94
R1218:Trrap UTSW 5 144816409 missense probably damaging 1.00
R1264:Trrap UTSW 5 144789599 splice site probably benign
R1374:Trrap UTSW 5 144846618 missense probably damaging 1.00
R1401:Trrap UTSW 5 144857422 missense possibly damaging 0.93
R1480:Trrap UTSW 5 144818313 missense probably benign
R1538:Trrap UTSW 5 144837202 missense possibly damaging 0.65
R1751:Trrap UTSW 5 144814575 critical splice donor site probably null
R1779:Trrap UTSW 5 144828590 missense probably benign 0.01
R1782:Trrap UTSW 5 144822703 missense possibly damaging 0.93
R1792:Trrap UTSW 5 144853586 missense possibly damaging 0.87
R1859:Trrap UTSW 5 144830951 missense probably benign 0.04
R1861:Trrap UTSW 5 144815917 splice site probably null
R1902:Trrap UTSW 5 144816053 missense probably damaging 1.00
R1903:Trrap UTSW 5 144816053 missense probably damaging 1.00
R2021:Trrap UTSW 5 144853488 missense possibly damaging 0.94
R2026:Trrap UTSW 5 144803044 missense possibly damaging 0.86
R2036:Trrap UTSW 5 144828562 missense probably benign 0.08
R2099:Trrap UTSW 5 144782239 missense possibly damaging 0.46
R2108:Trrap UTSW 5 144825874 missense probably benign 0.01
R2113:Trrap UTSW 5 144844211 missense probably damaging 1.00
R2174:Trrap UTSW 5 144821855 missense probably benign 0.40
R2442:Trrap UTSW 5 144817966 missense probably damaging 1.00
R2568:Trrap UTSW 5 144843369 critical splice donor site probably null
R3442:Trrap UTSW 5 144792252 missense probably benign 0.03
R3853:Trrap UTSW 5 144792165 missense probably damaging 1.00
R4401:Trrap UTSW 5 144843318 missense possibly damaging 0.60
R4493:Trrap UTSW 5 144831048 missense probably benign 0.21
R4524:Trrap UTSW 5 144825321 missense probably benign 0.38
R4569:Trrap UTSW 5 144792118 missense probably benign 0.13
R4672:Trrap UTSW 5 144785480 missense probably damaging 0.97
R4732:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4733:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4791:Trrap UTSW 5 144803277 missense probably damaging 1.00
R4795:Trrap UTSW 5 144832488 missense probably benign 0.06
R4827:Trrap UTSW 5 144800948 missense probably benign 0.02
R4839:Trrap UTSW 5 144845592 missense probably damaging 1.00
R4915:Trrap UTSW 5 144805735 missense probably damaging 0.99
R4951:Trrap UTSW 5 144805720 missense possibly damaging 0.65
R4959:Trrap UTSW 5 144856960 missense probably damaging 1.00
R5049:Trrap UTSW 5 144826717 missense probably damaging 1.00
R5074:Trrap UTSW 5 144851179 missense probably damaging 1.00
R5236:Trrap UTSW 5 144817786 missense probably benign 0.07
R5281:Trrap UTSW 5 144813503 missense probably benign 0.13
R5322:Trrap UTSW 5 144844224 missense probably damaging 1.00
R5457:Trrap UTSW 5 144849977 missense probably damaging 1.00
R5590:Trrap UTSW 5 144782265 missense probably benign 0.05
R5799:Trrap UTSW 5 144830945 missense probably benign
R5885:Trrap UTSW 5 144794793 missense probably damaging 1.00
R5905:Trrap UTSW 5 144849920 missense possibly damaging 0.95
R5908:Trrap UTSW 5 144786708 missense probably damaging 0.96
R5956:Trrap UTSW 5 144807391 splice site silent
R5992:Trrap UTSW 5 144810184 missense probably benign 0.00
R6017:Trrap UTSW 5 144844241 missense probably damaging 1.00
R6029:Trrap UTSW 5 144817679 missense possibly damaging 0.94
R6029:Trrap UTSW 5 144825914 missense possibly damaging 0.75
R6117:Trrap UTSW 5 144802961 missense possibly damaging 0.78
R6166:Trrap UTSW 5 144781981 missense possibly damaging 0.66
R6234:Trrap UTSW 5 144839713 intron probably null
R6288:Trrap UTSW 5 144811992 missense probably damaging 1.00
R6290:Trrap UTSW 5 144805018 missense probably damaging 1.00
R6316:Trrap UTSW 5 144813526 missense probably benign 0.02
R6398:Trrap UTSW 5 144790870 missense possibly damaging 0.83
R6413:Trrap UTSW 5 144784046 missense possibly damaging 0.83
R6499:Trrap UTSW 5 144857002 missense probably damaging 1.00
R6529:Trrap UTSW 5 144834204 missense probably benign 0.06
R6574:Trrap UTSW 5 144815550 critical splice donor site probably null
R6631:Trrap UTSW 5 144771650 missense possibly damaging 0.94
R6727:Trrap UTSW 5 144856950 missense probably damaging 1.00
R6776:Trrap UTSW 5 144851256 nonsense probably null
R6914:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6942:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6945:Trrap UTSW 5 144790855 missense possibly damaging 0.66
R7023:Trrap UTSW 5 144792154 missense possibly damaging 0.64
R7107:Trrap UTSW 5 144797135 missense probably benign 0.05
R7139:Trrap UTSW 5 144803178 missense possibly damaging 0.65
R7148:Trrap UTSW 5 144821803 missense possibly damaging 0.77
R7167:Trrap UTSW 5 144839614 missense probably benign 0.39
R7171:Trrap UTSW 5 144794049 missense probably damaging 1.00
R7215:Trrap UTSW 5 144797135 missense probably benign 0.05
R7255:Trrap UTSW 5 144858954 missense probably damaging 1.00
R7261:Trrap UTSW 5 144845477 missense possibly damaging 0.67
R7264:Trrap UTSW 5 144814523 missense probably benign 0.05
X0060:Trrap UTSW 5 144843361 missense probably damaging 0.96
Z1088:Trrap UTSW 5 144834197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGAGGAGGCCAACAAAGC -3'
(R):5'- TGCTGCAAACACTGACTCC -3'

Sequencing Primer
(F):5'- AACAAAGCGTTCTCGGCTG -3'
(R):5'- AAACACTGACTCCGGCTGTG -3'
Posted On2019-06-26