Incidental Mutation 'R7205:Abca15'
ID560528
Institutional Source Beutler Lab
Gene Symbol Abca15
Ensembl Gene ENSMUSG00000054746
Gene NameATP-binding cassette, sub-family A (ABC1), member 15
Synonyms4930500I12Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_177213.3; MGI:2388709

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7205 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120328670-120407687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120394364 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 1269 (K1269M)
Ref Sequence ENSEMBL: ENSMUSP00000075621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076272] [ENSMUST00000121265]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076272
AA Change: K1269M

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075621
Gene: ENSMUSG00000054746
AA Change: K1269M

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 5.7e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 892 1293 7.9e-24 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121265
AA Change: K1269M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112821
Gene: ENSMUSG00000054746
AA Change: K1269M

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 2.1e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 907 1293 1e-25 PFAM
AAA 1381 1565 1.16e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (99/102)
Allele List at MGI

All alleles(2) : Targeted(2

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,289,327 D2616E probably benign Het
5430419D17Rik T C 7: 131,277,623 probably null Het
Adgrl2 A T 3: 148,858,949 Y332N probably damaging Het
Adgrv1 C T 13: 81,479,658 V3695I probably benign Het
Aldh1l1 A T 6: 90,598,275 Y848F probably damaging Het
Ambra1 T C 2: 91,767,758 V88A possibly damaging Het
Ankrd12 C T 17: 65,985,165 R1091Q probably damaging Het
Apob T G 12: 8,005,087 V1362G probably damaging Het
Arhgap17 A G 7: 123,306,438 L328P probably damaging Het
Arhgap27 A C 11: 103,344,541 V9G probably benign Het
Arhgap33 A T 7: 30,533,009 D34E probably damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Atf6b T C 17: 34,653,729 Y575H probably damaging Het
BC100530 T C 16: 36,367,447 I19V probably benign Het
Bcl2l2 T G 14: 54,884,601 S74A probably benign Het
Begain T C 12: 109,038,868 T73A possibly damaging Het
Bicdl1 C T 5: 115,670,281 R264Q probably damaging Het
Ccdc180 A G 4: 45,914,588 D701G probably benign Het
Cd200r4 G T 16: 44,833,166 V146L probably damaging Het
Cd226 G A 18: 89,247,198 C200Y probably damaging Het
Cdk12 A G 11: 98,224,625 N864S unknown Het
Clcnkb A T 4: 141,408,635 L413Q probably damaging Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Cnn1 T A 9: 22,105,782 probably null Het
Cpa5 C A 6: 30,630,830 Q364K probably benign Het
Ddx11 A G 17: 66,130,771 E164G probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Drc7 T A 8: 95,077,921 Y855N probably damaging Het
Fam20b C A 1: 156,702,398 probably null Het
Fip1l1 T A 5: 74,588,075 probably null Het
Flt4 A G 11: 49,634,298 D657G probably null Het
Fmo3 T A 1: 162,954,288 T499S possibly damaging Het
Fyco1 C T 9: 123,822,426 G1190S probably benign Het
Galnt17 C A 5: 131,306,752 probably benign Het
Ggcx T C 6: 72,428,004 I465T probably damaging Het
Gm11238 A G 4: 73,654,920 Y132C probably damaging Het
Gm281 T C 14: 13,866,032 T286A Het
Gm4788 A T 1: 139,753,050 Y243* probably null Het
Gm7361 T A 5: 26,261,118 N159K probably damaging Het
Golgb1 A G 16: 36,875,301 N54S unknown Het
Grin2c G A 11: 115,251,050 P848S probably damaging Het
Grina T C 15: 76,249,087 V285A probably damaging Het
Gtpbp6 A G 5: 110,104,612 L381P probably damaging Het
Herc2 G T 7: 56,182,640 G3028V probably damaging Het
Ibsp A T 5: 104,310,431 Y278F probably damaging Het
Ints4 T A 7: 97,535,226 L846* probably null Het
Kif17 A G 4: 138,293,766 K849E probably benign Het
Krt77 G A 15: 101,869,371 P83L probably benign Het
Ky T G 9: 102,542,292 D499E probably damaging Het
Lrp3 A T 7: 35,202,626 M610K probably damaging Het
Lrrfip1 T A 1: 91,091,616 D156E probably benign Het
Map6 C A 7: 99,269,050 H343Q probably benign Het
Micu2 G T 14: 57,954,149 D148E probably benign Het
Mks1 T A 11: 87,856,602 S153T probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myh9 T C 15: 77,783,472 K587R probably benign Het
Neb T C 2: 52,196,356 Y5478C probably damaging Het
Nelfe G A 17: 34,850,936 probably null Het
Nps T A 7: 135,268,781 L11I probably damaging Het
Nsd1 A T 13: 55,246,470 D731V probably damaging Het
Nup50 A G 15: 84,933,658 T93A probably benign Het
Nup98 A T 7: 102,195,041 F29Y unknown Het
Olfr1195 T C 2: 88,683,423 H103R possibly damaging Het
Olfr1414 A T 1: 92,511,851 M59K probably benign Het
Olfr212 A G 6: 116,515,975 Y66C probably damaging Het
Olfr469 T C 7: 107,822,575 N298S probably benign Het
Oprd1 A G 4: 132,113,801 I282T probably damaging Het
Osbp2 T C 11: 3,712,134 I240V probably damaging Het
Otub2 C A 12: 103,392,904 P84Q probably benign Het
Parp9 A T 16: 35,956,990 I435F probably benign Het
Pcdh18 C T 3: 49,755,474 R464H probably benign Het
Pcsk6 G T 7: 66,025,408 probably null Het
Ptgs2 G A 1: 150,102,761 R208Q probably benign Het
Rab11b G A 17: 33,749,867 R51C probably damaging Het
Rad1 A G 15: 10,493,257 I257V probably benign Het
Rbms3 C T 9: 116,586,017 probably null Het
Rxfp2 A T 5: 150,059,899 I300L probably benign Het
Rxfp2 C A 5: 150,059,903 T301K probably benign Het
Sars2 G T 7: 28,744,308 A112S probably benign Het
Scn10a T C 9: 119,613,550 D1543G probably damaging Het
Serpinb1b A G 13: 33,087,423 H59R probably benign Het
Sgsm2 T A 11: 74,854,493 D661V possibly damaging Het
Smad6 C A 9: 64,020,406 V207L probably damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Tenm2 C T 11: 36,049,129 R1390Q probably damaging Het
Tmem132a T A 19: 10,866,931 Q101L probably damaging Het
Tmem151a A G 19: 5,082,773 V135A probably damaging Het
Trappc10 T C 10: 78,210,428 K443E probably damaging Het
Trrap A T 5: 144,842,707 N3161I possibly damaging Het
Tspan32 G T 7: 143,005,126 R6L possibly damaging Het
Ugt2a2 T C 5: 87,460,609 D457G possibly damaging Het
Ulk2 A T 11: 61,834,831 S140T possibly damaging Het
Upf1 C T 8: 70,340,045 A338T possibly damaging Het
Usp43 C T 11: 67,883,284 R460Q probably null Het
Uxs1 A G 1: 43,816,958 probably benign Het
Vmn1r59 A G 7: 5,454,726 C12R probably damaging Het
Wdr64 A G 1: 175,789,933 D693G probably benign Het
Wnk1 A T 6: 119,943,878 probably null Het
Wnt2 G T 6: 18,028,047 R63S probably benign Het
Zcchc6 C G 13: 59,788,550 D1246H probably damaging Het
Zfp418 A T 7: 7,181,563 Q175L probably benign Het
Other mutations in Abca15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca15 APN 7 120397054 missense probably damaging 1.00
IGL00505:Abca15 APN 7 120369236 critical splice donor site probably null
IGL00851:Abca15 APN 7 120340007 missense probably damaging 1.00
IGL00985:Abca15 APN 7 120397018 missense probably damaging 1.00
IGL01114:Abca15 APN 7 120361420 missense probably damaging 0.99
IGL01287:Abca15 APN 7 120332858 utr 3 prime probably benign
IGL01333:Abca15 APN 7 120382308 missense probably damaging 1.00
IGL01482:Abca15 APN 7 120382746 missense probably benign 0.00
IGL01610:Abca15 APN 7 120340644 missense probably damaging 0.98
IGL02238:Abca15 APN 7 120396606 missense probably benign 0.02
IGL02377:Abca15 APN 7 120365910 splice site probably benign
IGL02666:Abca15 APN 7 120335208 missense probably damaging 1.00
IGL02836:Abca15 APN 7 120388216 missense probably benign
IGL03337:Abca15 APN 7 120396707 missense probably benign 0.24
IGL03354:Abca15 APN 7 120394488 nonsense probably null
H8562:Abca15 UTSW 7 120374854 splice site probably benign
IGL03098:Abca15 UTSW 7 120388276 splice site probably null
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0076:Abca15 UTSW 7 120373685 splice site probably benign
R0165:Abca15 UTSW 7 120350903 splice site probably benign
R0311:Abca15 UTSW 7 120402904 missense probably damaging 0.98
R0387:Abca15 UTSW 7 120332852 critical splice donor site probably null
R0610:Abca15 UTSW 7 120365786 missense possibly damaging 0.75
R0612:Abca15 UTSW 7 120337255 missense probably damaging 1.00
R0704:Abca15 UTSW 7 120354523 missense probably damaging 0.98
R0890:Abca15 UTSW 7 120373713 missense probably benign 0.01
R0961:Abca15 UTSW 7 120360985 nonsense probably null
R1144:Abca15 UTSW 7 120360860 splice site probably benign
R1412:Abca15 UTSW 7 120345323 missense possibly damaging 0.93
R1419:Abca15 UTSW 7 120374902 missense probably benign 0.10
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1493:Abca15 UTSW 7 120382290 missense probably benign 0.00
R1513:Abca15 UTSW 7 120340099 missense probably damaging 0.96
R1702:Abca15 UTSW 7 120382702 missense probably benign 0.10
R1857:Abca15 UTSW 7 120361369 missense probably damaging 1.00
R1893:Abca15 UTSW 7 120340553 missense possibly damaging 0.85
R1901:Abca15 UTSW 7 120346099 missense probably damaging 1.00
R1951:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1953:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1962:Abca15 UTSW 7 120341245 missense probably damaging 1.00
R2063:Abca15 UTSW 7 120360904 missense possibly damaging 0.61
R2141:Abca15 UTSW 7 120407474 missense probably damaging 1.00
R2145:Abca15 UTSW 7 120354478 missense probably benign 0.08
R2182:Abca15 UTSW 7 120340227 nonsense probably null
R2425:Abca15 UTSW 7 120359810 missense probably damaging 1.00
R2444:Abca15 UTSW 7 120365897 missense probably damaging 1.00
R3023:Abca15 UTSW 7 120382779 missense probably benign 0.40
R3079:Abca15 UTSW 7 120385169 missense probably damaging 1.00
R3106:Abca15 UTSW 7 120396633 missense possibly damaging 0.63
R3622:Abca15 UTSW 7 120350813 nonsense probably null
R4085:Abca15 UTSW 7 120382726 missense probably damaging 1.00
R4233:Abca15 UTSW 7 120402979 nonsense probably null
R4591:Abca15 UTSW 7 120382413 missense probably damaging 1.00
R4612:Abca15 UTSW 7 120335161 missense probably benign 0.03
R4721:Abca15 UTSW 7 120350775 missense probably benign 0.01
R4838:Abca15 UTSW 7 120345300 missense probably benign 0.00
R4940:Abca15 UTSW 7 120332694 missense probably benign
R4963:Abca15 UTSW 7 120360919 missense probably damaging 1.00
R4993:Abca15 UTSW 7 120401718 missense probably damaging 0.99
R5022:Abca15 UTSW 7 120346096 missense probably damaging 0.98
R5030:Abca15 UTSW 7 120340001 missense probably damaging 1.00
R5072:Abca15 UTSW 7 120406975 missense probably damaging 1.00
R5090:Abca15 UTSW 7 120385199 missense probably damaging 1.00
R5309:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5310:Abca15 UTSW 7 120332616 missense possibly damaging 0.46
R5312:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5482:Abca15 UTSW 7 120369147 missense probably damaging 1.00
R5596:Abca15 UTSW 7 120401749 missense possibly damaging 0.94
R5853:Abca15 UTSW 7 120340583 missense probably benign 0.00
R5950:Abca15 UTSW 7 120382656 missense probably damaging 1.00
R5953:Abca15 UTSW 7 120361018 missense probably damaging 1.00
R6072:Abca15 UTSW 7 120388258 missense probably damaging 0.98
R6131:Abca15 UTSW 7 120340205 missense probably benign 0.03
R6132:Abca15 UTSW 7 120361420 missense probably benign 0.14
R6136:Abca15 UTSW 7 120340049 missense possibly damaging 0.81
R6207:Abca15 UTSW 7 120373794 missense probably benign 0.01
R6315:Abca15 UTSW 7 120346092 missense probably damaging 1.00
R6417:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6420:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6595:Abca15 UTSW 7 120394487 missense probably benign 0.00
R6653:Abca15 UTSW 7 120346006 missense probably benign 0.03
R6859:Abca15 UTSW 7 120402994 nonsense probably null
R6983:Abca15 UTSW 7 120354463 missense probably benign 0.26
R7127:Abca15 UTSW 7 120332602 missense probably benign 0.06
R7336:Abca15 UTSW 7 120388233 missense possibly damaging 0.66
R7426:Abca15 UTSW 7 120345998 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTTCTCAAACTCTGAAGACTGTGTC -3'
(R):5'- CCTACTTTCCATGCTGCTAGAG -3'

Sequencing Primer
(F):5'- GTTCACATCAGTGTTGCA -3'
(R):5'- ACTTTCCATGCTGCTAGAGTTTTG -3'
Posted On2019-06-26