Incidental Mutation 'R7205:Micu2'
ID560564
Institutional Source Beutler Lab
Gene Symbol Micu2
Ensembl Gene ENSMUSG00000021973
Gene Namemitochondrial calcium uptake 2
Synonyms4833427E09Rik, 1110008L20Rik, Efha1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7205 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location57916261-57999262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 57954149 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 148 (D148E)
Ref Sequence ENSEMBL: ENSMUSP00000022543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022543]
Predicted Effect probably benign
Transcript: ENSMUST00000022543
AA Change: D148E

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022543
Gene: ENSMUSG00000021973
AA Change: D148E

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 35 50 N/A INTRINSIC
EFh 173 201 1.15e0 SMART
EFh 363 391 1.12e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit an enlarged heart left atrium along with delayed calcium reuptake and decreased relaxation rates by cardiomyocytes, and develop abdominal aortic aneurysms with spontaneous rupture following angiotensin II treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,289,327 D2616E probably benign Het
5430419D17Rik T C 7: 131,277,623 probably null Het
Abca15 A T 7: 120,394,364 K1269M possibly damaging Het
Adgrl2 A T 3: 148,858,949 Y332N probably damaging Het
Adgrv1 C T 13: 81,479,658 V3695I probably benign Het
Aldh1l1 A T 6: 90,598,275 Y848F probably damaging Het
Ambra1 T C 2: 91,767,758 V88A possibly damaging Het
Ankrd12 C T 17: 65,985,165 R1091Q probably damaging Het
Apob T G 12: 8,005,087 V1362G probably damaging Het
Arhgap17 A G 7: 123,306,438 L328P probably damaging Het
Arhgap27 A C 11: 103,344,541 V9G probably benign Het
Arhgap33 A T 7: 30,533,009 D34E probably damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Atf6b T C 17: 34,653,729 Y575H probably damaging Het
BC100530 T C 16: 36,367,447 I19V probably benign Het
Bcl2l2 T G 14: 54,884,601 S74A probably benign Het
Begain T C 12: 109,038,868 T73A possibly damaging Het
Bicdl1 C T 5: 115,670,281 R264Q probably damaging Het
Ccdc180 A G 4: 45,914,588 D701G probably benign Het
Cd200r4 G T 16: 44,833,166 V146L probably damaging Het
Cd226 G A 18: 89,247,198 C200Y probably damaging Het
Cdk12 A G 11: 98,224,625 N864S unknown Het
Clcnkb A T 4: 141,408,635 L413Q probably damaging Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Cnn1 T A 9: 22,105,782 probably null Het
Cpa5 C A 6: 30,630,830 Q364K probably benign Het
Ddx11 A G 17: 66,130,771 E164G probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Drc7 T A 8: 95,077,921 Y855N probably damaging Het
Fam20b C A 1: 156,702,398 probably null Het
Flt4 A G 11: 49,634,298 D657G probably null Het
Fmo3 T A 1: 162,954,288 T499S possibly damaging Het
Fyco1 C T 9: 123,822,426 G1190S probably benign Het
Galnt17 C A 5: 131,306,752 probably benign Het
Ggcx T C 6: 72,428,004 I465T probably damaging Het
Gm11238 A G 4: 73,654,920 Y132C probably damaging Het
Gm281 T C 14: 13,866,032 T286A Het
Gm4788 A T 1: 139,753,050 Y243* probably null Het
Gm7361 T A 5: 26,261,118 N159K probably damaging Het
Golgb1 A G 16: 36,875,301 N54S unknown Het
Grin2c G A 11: 115,251,050 P848S probably damaging Het
Grina T C 15: 76,249,087 V285A probably damaging Het
Gtpbp6 A G 5: 110,104,612 L381P probably damaging Het
Herc2 G T 7: 56,182,640 G3028V probably damaging Het
Ibsp A T 5: 104,310,431 Y278F probably damaging Het
Ints4 T A 7: 97,535,226 L846* probably null Het
Kif17 A G 4: 138,293,766 K849E probably benign Het
Krt77 G A 15: 101,869,371 P83L probably benign Het
Ky T G 9: 102,542,292 D499E probably damaging Het
Lrp3 A T 7: 35,202,626 M610K probably damaging Het
Lrrfip1 T A 1: 91,091,616 D156E probably benign Het
Map6 C A 7: 99,269,050 H343Q probably benign Het
Mks1 T A 11: 87,856,602 S153T probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myh9 T C 15: 77,783,472 K587R probably benign Het
Neb T C 2: 52,196,356 Y5478C probably damaging Het
Nps T A 7: 135,268,781 L11I probably damaging Het
Nsd1 A T 13: 55,246,470 D731V probably damaging Het
Nup50 A G 15: 84,933,658 T93A probably benign Het
Nup98 A T 7: 102,195,041 F29Y unknown Het
Olfr1195 T C 2: 88,683,423 H103R possibly damaging Het
Olfr1414 A T 1: 92,511,851 M59K probably benign Het
Olfr212 A G 6: 116,515,975 Y66C probably damaging Het
Olfr469 T C 7: 107,822,575 N298S probably benign Het
Oprd1 A G 4: 132,113,801 I282T probably damaging Het
Osbp2 T C 11: 3,712,134 I240V probably damaging Het
Otub2 C A 12: 103,392,904 P84Q probably benign Het
Parp9 A T 16: 35,956,990 I435F probably benign Het
Pcdh18 C T 3: 49,755,474 R464H probably benign Het
Pcsk6 G T 7: 66,025,408 probably null Het
Ptgs2 G A 1: 150,102,761 R208Q probably benign Het
Rab11b G A 17: 33,749,867 R51C probably damaging Het
Rad1 A G 15: 10,493,257 I257V probably benign Het
Rbms3 C T 9: 116,586,017 probably null Het
Rxfp2 A T 5: 150,059,899 I300L probably benign Het
Rxfp2 C A 5: 150,059,903 T301K probably benign Het
Sars2 G T 7: 28,744,308 A112S probably benign Het
Scn10a T C 9: 119,613,550 D1543G probably damaging Het
Serpinb1b A G 13: 33,087,423 H59R probably benign Het
Sgsm2 T A 11: 74,854,493 D661V possibly damaging Het
Smad6 C A 9: 64,020,406 V207L probably damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Tenm2 C T 11: 36,049,129 R1390Q probably damaging Het
Tmem132a T A 19: 10,866,931 Q101L probably damaging Het
Tmem151a A G 19: 5,082,773 V135A probably damaging Het
Trappc10 T C 10: 78,210,428 K443E probably damaging Het
Trrap A T 5: 144,842,707 N3161I possibly damaging Het
Tspan32 G T 7: 143,005,126 R6L possibly damaging Het
Ugt2a2 T C 5: 87,460,609 D457G possibly damaging Het
Ulk2 A T 11: 61,834,831 S140T possibly damaging Het
Upf1 C T 8: 70,340,045 A338T possibly damaging Het
Usp43 C T 11: 67,883,284 R460Q probably null Het
Vmn1r59 A G 7: 5,454,726 C12R probably damaging Het
Wdr64 A G 1: 175,789,933 D693G probably benign Het
Wnt2 G T 6: 18,028,047 R63S probably benign Het
Zcchc6 C G 13: 59,788,550 D1246H probably damaging Het
Zfp418 A T 7: 7,181,563 Q175L probably benign Het
Other mutations in Micu2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Micu2 APN 14 57943625 missense probably damaging 1.00
IGL02416:Micu2 APN 14 57923965 missense probably damaging 0.99
IGL02675:Micu2 APN 14 57945377 splice site probably benign
IGL03343:Micu2 APN 14 57917311 missense probably benign 0.01
ANU22:Micu2 UTSW 14 57943625 missense probably damaging 1.00
R0238:Micu2 UTSW 14 57917378 splice site probably benign
R0239:Micu2 UTSW 14 57917378 splice site probably benign
R0488:Micu2 UTSW 14 57932242 missense probably benign 0.00
R0564:Micu2 UTSW 14 57919374 missense possibly damaging 0.82
R1116:Micu2 UTSW 14 57954200 missense probably benign 0.00
R1471:Micu2 UTSW 14 57945397 missense probably damaging 0.99
R2011:Micu2 UTSW 14 57954133 splice site probably null
R4226:Micu2 UTSW 14 57932285 missense possibly damaging 0.92
R5595:Micu2 UTSW 14 57971744 missense probably damaging 1.00
R6583:Micu2 UTSW 14 57943670 missense probably damaging 0.99
R6800:Micu2 UTSW 14 57919439 missense possibly damaging 0.89
R7125:Micu2 UTSW 14 57971781 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTATGCCATGAAACACCTATTGTATC -3'
(R):5'- AGGCCTGGCTTCTCTTTTGT -3'

Sequencing Primer
(F):5'- GAAACACCTATTGTATCACATGGC -3'
(R):5'- CAATTGCTGGGCATAGAATCTCCTG -3'
Posted On2019-06-26