Incidental Mutation 'R7207:Agap1'
ID560673
Institutional Source Beutler Lab
Gene Symbol Agap1
Ensembl Gene ENSMUSG00000055013
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 1
SynonymsGgap1, Centg2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7207 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location89454806-89897617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89843099 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 657 (H657L)
Ref Sequence ENSEMBL: ENSMUSP00000027521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027521] [ENSMUST00000074945] [ENSMUST00000190096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027521
AA Change: H657L

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027521
Gene: ENSMUSG00000055013
AA Change: H657L

DomainStartEndE-ValueType
Pfam:Ras 73 231 1.1e-18 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 590 1.36e-15 SMART
ArfGap 609 729 4.58e-51 SMART
ANK 768 797 1.83e-3 SMART
ANK 801 832 1.33e2 SMART
low complexity region 840 852 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000074945
AA Change: H470L

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074478
Gene: ENSMUSG00000055013
AA Change: H470L

DomainStartEndE-ValueType
Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190096
AA Change: H604L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140599
Gene: ENSMUSG00000055013
AA Change: H604L

DomainStartEndE-ValueType
Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an ADP-ribosylation factor GTPase-activating protein family involved in membrane trafficking and cytoskeleton dynamics. This gene functions as a direct regulator of the adaptor-related protein complex 3 on endosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,550,771 Y1019H probably benign Het
Adam11 C A 11: 102,772,057 A212D probably benign Het
Adamts13 C A 2: 26,978,695 H230Q probably damaging Het
Adgrl3 G A 5: 81,310,027 M1I probably null Het
Ano3 T C 2: 110,781,423 D238G probably damaging Het
Atp8b5 A T 4: 43,357,018 I589F probably damaging Het
Bmp1 C T 14: 70,479,560 A859T possibly damaging Het
Cdh20 C A 1: 104,993,977 D666E probably damaging Het
Cep135 T G 5: 76,632,243 D807E probably benign Het
Cldn13 G A 5: 134,914,912 H140Y probably benign Het
Cnksr1 G T 4: 134,235,123 Q155K possibly damaging Het
Col1a1 G A 11: 94,938,526 R121Q unknown Het
Coro6 G A 11: 77,467,263 A225T possibly damaging Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Dhrs7b C A 11: 60,855,797 Y237* probably null Het
Dnah3 A G 7: 119,971,089 F2303L probably damaging Het
Dsg2 T A 18: 20,601,459 D831E probably damaging Het
Dst T C 1: 34,163,337 S575P probably damaging Het
Epg5 T C 18: 77,948,955 L289P probably damaging Het
Etl4 A G 2: 20,709,576 N162S probably damaging Het
Fbf1 A T 11: 116,149,474 Y602N probably benign Het
Fgd4 A T 16: 16,484,556 M45K probably benign Het
Fryl C T 5: 73,065,095 V2048I probably benign Het
Gm13119 A G 4: 144,361,903 T90A probably benign Het
Gulp1 T C 1: 44,766,132 V127A possibly damaging Het
H2-DMb1 T A 17: 34,157,516 I203N probably damaging Het
Harbi1 T C 2: 91,712,445 S84P probably damaging Het
Hrh2 T C 13: 54,214,247 S81P possibly damaging Het
Iars T C 13: 49,688,315 probably null Het
Kcnma1 T C 14: 23,309,015 *1087W probably null Het
Lama5 T A 2: 180,207,084 N241I probably damaging Het
Lig4 T A 8: 9,972,101 K560* probably null Het
Lpin3 G T 2: 160,894,003 E68* probably null Het
Mkl2 A T 16: 13,326,436 I7L probably benign Het
Msrb3 A T 10: 120,791,400 probably null Het
Muc5b A G 7: 141,862,865 T3183A probably benign Het
Mx1 T A 16: 97,452,198 D342V probably benign Het
Nrap G T 19: 56,345,521 T1003K probably damaging Het
Olfr1037 A G 2: 86,084,815 S321P possibly damaging Het
Plxna2 C T 1: 194,644,019 P87L probably damaging Het
Pms2 C T 5: 143,913,634 T89I probably damaging Het
Ppp1r12c C A 7: 4,489,868 R203L probably damaging Het
Rab44 C T 17: 29,138,039 Q48* probably null Het
Rgs14 T C 13: 55,383,234 V417A probably benign Het
Sgms1 T A 19: 32,142,747 K253M probably null Het
Sidt2 T C 9: 45,945,151 Y492C probably damaging Het
Slco1a5 G T 6: 142,248,749 Y389* probably null Het
Slfn14 G A 11: 83,279,388 Q477* probably null Het
Sorbs3 T C 14: 70,201,485 K142R probably damaging Het
Sphk1 A T 11: 116,535,764 D182V probably damaging Het
Srsf9 C G 5: 115,327,422 Y38* probably null Het
Stk40 A C 4: 126,125,754 E107A probably damaging Het
Syngr4 T C 7: 45,888,677 Y89C possibly damaging Het
Tead1 G A 7: 112,842,080 R109H possibly damaging Het
Thra A G 11: 98,760,976 Q108R probably damaging Het
Tnni3k G A 3: 154,875,145 T621I probably damaging Het
Trim3 A C 7: 105,613,376 V525G possibly damaging Het
Usp49 T C 17: 47,678,877 V529A probably benign Het
Vill A T 9: 119,071,213 Q849L possibly damaging Het
Vps36 T A 8: 22,211,607 S237T probably benign Het
Zar1l A T 5: 150,507,093 C284* probably null Het
Zfp948 T C 17: 21,588,340 V598A possibly damaging Het
Zfp952 T C 17: 33,003,515 Y323H possibly damaging Het
Other mutations in Agap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Agap1 APN 1 89663796 splice site probably benign
IGL00310:Agap1 APN 1 89887670 missense probably damaging 1.00
IGL01104:Agap1 APN 1 89726075 splice site probably benign
IGL02227:Agap1 APN 1 89663775 missense probably damaging 0.99
IGL02959:Agap1 APN 1 89843191 missense possibly damaging 0.94
IGL03303:Agap1 APN 1 89665152 missense probably damaging 1.00
K3955:Agap1 UTSW 1 89887604 missense probably damaging 1.00
R0030:Agap1 UTSW 1 89888744 nonsense probably null
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0400:Agap1 UTSW 1 89843250 splice site probably benign
R1104:Agap1 UTSW 1 89789240 missense probably damaging 0.99
R1160:Agap1 UTSW 1 89843154 missense probably damaging 0.98
R1439:Agap1 UTSW 1 89843186 missense probably damaging 1.00
R1454:Agap1 UTSW 1 89837806 splice site probably null
R1644:Agap1 UTSW 1 89663730 missense probably damaging 0.97
R1984:Agap1 UTSW 1 89766323 missense probably benign
R2141:Agap1 UTSW 1 89837755 missense probably damaging 0.99
R3966:Agap1 UTSW 1 89834461 missense probably damaging 0.99
R4195:Agap1 UTSW 1 89834539 missense probably damaging 0.99
R4669:Agap1 UTSW 1 89837806 splice site probably null
R4951:Agap1 UTSW 1 89609503 missense probably damaging 1.00
R5525:Agap1 UTSW 1 89743773 missense possibly damaging 0.86
R5843:Agap1 UTSW 1 89609550 missense probably damaging 0.97
R5930:Agap1 UTSW 1 89843096 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R6879:Agap1 UTSW 1 89766455 missense probably benign 0.25
R7027:Agap1 UTSW 1 89888722 missense probably benign 0.00
R7268:Agap1 UTSW 1 89766348 missense probably benign 0.02
R7289:Agap1 UTSW 1 89455431 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- AGTCATATGGGGACTGACTAGTTG -3'
(R):5'- AGTTGTAAGTGCCCTGGCTG -3'

Sequencing Primer
(F):5'- ACTAGTTGTTGAGGTGAGAATCCAG -3'
(R):5'- ATCCCCAGCCGTGTAACTG -3'
Posted On2019-06-26