Incidental Mutation 'R7208:Cdh20'
ID560839
Institutional Source Beutler Lab
Gene Symbol Cdh20
Ensembl Gene ENSMUSG00000050840
Gene Namecadherin 20
SynonymsCdh7
MMRRC Submission
Accession Numbers

Genbank: NM_011800

Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R7208 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location104768529-104995481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104954071 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 420 (N420K)
Ref Sequence ENSEMBL: ENSMUSP00000052078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062528]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062528
AA Change: N420K

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: N420K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
CA 82 163 1.01e-15 SMART
CA 187 272 1.35e-30 SMART
CA 296 388 1.98e-14 SMART
CA 411 492 1.61e-23 SMART
CA 515 602 3.9e-13 SMART
transmembrane domain 620 642 N/A INTRINSIC
Pfam:Cadherin_C 645 793 2.6e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,308,645 probably null Het
Aass T C 6: 23,074,630 K854E probably damaging Het
Abcd2 G T 15: 91,190,682 Y309* probably null Het
Ache G A 5: 137,291,489 G360D probably damaging Het
Acot12 T C 13: 91,781,242 L396P probably benign Het
Acox2 T G 14: 8,241,303 D603A probably benign Het
Adam3 C A 8: 24,711,401 K245N probably damaging Het
Ankhd1 T C 18: 36,625,028 I925T probably benign Het
Arhgap27 C T 11: 103,360,759 V48M probably damaging Het
Atm A T 9: 53,512,008 probably null Het
B4galt4 T A 16: 38,753,940 F92Y probably damaging Het
Brwd1 C T 16: 96,035,959 R891Q probably damaging Het
Calcr T C 6: 3,687,612 Q462R probably benign Het
Ccdc112 T C 18: 46,287,631 R351G probably damaging Het
Ccdc80 T G 16: 45,096,710 S610A probably benign Het
Cntn3 G A 6: 102,278,422 R172* probably null Het
Ctnnd1 G T 2: 84,622,046 Q78K possibly damaging Het
D16Ertd472e A T 16: 78,575,926 L41H probably damaging Het
Dclk2 A T 3: 86,799,602 probably null Het
Dmwd C T 7: 19,080,309 H295Y probably benign Het
Dnaic2 T C 11: 114,757,162 V588A unknown Het
Dtx4 C T 19: 12,482,073 probably null Het
Dync2h1 C A 9: 7,141,059 D1323Y probably damaging Het
Fcgbp T A 7: 28,104,021 H1683Q probably benign Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Gm4070 A C 7: 105,902,179 S555R possibly damaging Het
Gm9195 A G 14: 72,451,752 S1876P possibly damaging Het
Grhl2 A C 15: 37,335,736 K431T probably damaging Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gtf2ird1 T C 5: 134,411,094 N94S probably benign Het
Hmgcs1 G T 13: 119,701,084 G195W probably damaging Het
Hrc A T 7: 45,336,565 Y380F possibly damaging Het
Kcnu1 C T 8: 25,919,637 Q863* probably null Het
Lemd2 G A 17: 27,196,191 P300L probably damaging Het
Lnpep A T 17: 17,552,910 Y665* probably null Het
Lrfn1 A G 7: 28,467,139 T653A probably benign Het
Ly6g6c A G 17: 35,067,411 T8A unknown Het
Mcm5 T C 8: 75,121,716 probably null Het
Med28 A T 5: 45,523,452 D86V probably damaging Het
Mup11 A G 4: 60,659,726 S171P possibly damaging Het
Nckap1 A G 2: 80,540,198 F383L probably benign Het
Nid1 G C 13: 13,468,385 G303R probably benign Het
Nkain3 A G 4: 20,282,892 V147A probably benign Het
Olfr361 A G 2: 37,085,658 V30A probably benign Het
Pde9a G A 17: 31,420,284 V63I possibly damaging Het
Pdlim2 T A 14: 70,174,377 I69F probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phf20l1 T C 15: 66,604,789 I245T probably benign Het
Prmt8 C T 6: 127,689,829 R394H possibly damaging Het
Prpf4b T A 13: 34,884,011 D274E unknown Het
Psmd6 A T 14: 14,112,225 probably null Het
Rgs16 T C 1: 153,741,670 L69P probably damaging Het
Robo3 A T 9: 37,424,724 I482N probably damaging Het
Scara3 C T 14: 65,931,266 V301I possibly damaging Het
Serpina1b T A 12: 103,728,294 H397L probably benign Het
Skint11 T A 4: 114,231,747 L246Q probably damaging Het
Skint5 T A 4: 113,539,339 R1212S unknown Het
Slc11a2 T C 15: 100,402,332 D348G probably benign Het
Slc15a2 T C 16: 36,756,281 K495E probably benign Het
Son T G 16: 91,662,102 D2072E unknown Het
Stau1 A G 2: 166,963,574 V34A probably damaging Het
Stk3 G T 15: 35,073,116 L153I possibly damaging Het
Swi5 A T 2: 32,287,910 V13E probably benign Het
Syne2 A T 12: 76,031,398 probably null Het
Synm T C 7: 67,734,915 M558V probably benign Het
Tep1 T A 14: 50,824,556 probably null Het
Tmc6 A G 11: 117,776,325 V149A probably benign Het
Tmem214 T A 5: 30,870,721 V95E possibly damaging Het
Tnnt2 T A 1: 135,850,376 probably null Het
Txlna A G 4: 129,631,278 probably null Het
Vmn2r26 T C 6: 124,061,989 I841T probably damaging Het
Wasf2 G A 4: 133,195,734 V452I probably damaging Het
Wdr62 C T 7: 30,252,336 D673N probably damaging Het
Wdr78 T G 4: 103,066,352 I427L probably benign Het
Wdr95 C T 5: 149,595,371 T559I probably benign Het
Zbtb40 A T 4: 136,999,626 probably null Het
Zfat T C 15: 68,180,007 E646G probably benign Het
Other mutations in Cdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cdh20 APN 1 104953887 missense probably benign 0.05
IGL00743:Cdh20 APN 1 104947428 missense probably benign 0.06
IGL00848:Cdh20 APN 1 104934256 missense probably benign
IGL01393:Cdh20 APN 1 104934244 missense probably benign
IGL01396:Cdh20 APN 1 104947429 missense possibly damaging 0.59
IGL01485:Cdh20 APN 1 104934107 missense probably benign 0.05
IGL01612:Cdh20 APN 1 104994170 missense probably benign 0.02
IGL01947:Cdh20 APN 1 104993924 missense possibly damaging 0.91
IGL01967:Cdh20 APN 1 104941037 missense probably damaging 1.00
IGL02226:Cdh20 APN 1 104954091 splice site probably benign
IGL02318:Cdh20 APN 1 104954039 missense probably null 0.03
IGL02326:Cdh20 APN 1 104975039 missense probably damaging 0.97
IGL02798:Cdh20 APN 1 104947465 missense probably damaging 0.97
IGL02963:Cdh20 APN 1 104934098 start codon destroyed probably null 0.66
IGL03081:Cdh20 APN 1 104941257 missense probably damaging 1.00
3-1:Cdh20 UTSW 1 104947420 missense possibly damaging 0.84
IGL02991:Cdh20 UTSW 1 104934247 missense probably benign
R0178:Cdh20 UTSW 1 104975051 missense possibly damaging 0.82
R1114:Cdh20 UTSW 1 104979014 missense probably damaging 0.96
R1401:Cdh20 UTSW 1 104947497 missense possibly damaging 0.65
R1502:Cdh20 UTSW 1 104954030 missense probably benign 0.06
R1764:Cdh20 UTSW 1 104934345 splice site probably benign
R2198:Cdh20 UTSW 1 104947322 critical splice acceptor site probably null
R2279:Cdh20 UTSW 1 104947414 missense probably damaging 1.00
R2419:Cdh20 UTSW 1 104975015 missense possibly damaging 0.92
R2897:Cdh20 UTSW 1 104947474 missense probably damaging 1.00
R4243:Cdh20 UTSW 1 104942143 missense probably damaging 1.00
R4244:Cdh20 UTSW 1 104942143 missense probably damaging 1.00
R4349:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4350:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4352:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4353:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4719:Cdh20 UTSW 1 104934310 missense probably damaging 0.97
R4754:Cdh20 UTSW 1 104984685 missense probably damaging 0.99
R4795:Cdh20 UTSW 1 104941264 missense probably damaging 1.00
R4796:Cdh20 UTSW 1 104941264 missense probably damaging 1.00
R4955:Cdh20 UTSW 1 104984803 missense probably damaging 1.00
R5056:Cdh20 UTSW 1 104953997 missense probably benign 0.00
R5127:Cdh20 UTSW 1 104947348 missense probably damaging 1.00
R5269:Cdh20 UTSW 1 104934157 missense possibly damaging 0.67
R5563:Cdh20 UTSW 1 104947357 missense probably benign 0.29
R5634:Cdh20 UTSW 1 104975075 missense probably damaging 0.97
R5708:Cdh20 UTSW 1 104984910 missense probably damaging 1.00
R5822:Cdh20 UTSW 1 104934098 start codon destroyed probably null 0.49
R5933:Cdh20 UTSW 1 104984671 missense probably damaging 1.00
R6109:Cdh20 UTSW 1 104994014 missense probably damaging 1.00
R6521:Cdh20 UTSW 1 104942134 missense probably damaging 1.00
R6911:Cdh20 UTSW 1 104984686 missense possibly damaging 0.95
R7169:Cdh20 UTSW 1 104947353 missense possibly damaging 0.91
R7207:Cdh20 UTSW 1 104993977 missense probably damaging 0.98
R7297:Cdh20 UTSW 1 104970873 missense probably benign
R7535:Cdh20 UTSW 1 104975043 missense not run
Predicted Primers PCR Primer
(F):5'- TGAACCTTGGCCCATTTCAG -3'
(R):5'- AGCTCTGACTGAGATGTAAGGG -3'

Sequencing Primer
(F):5'- TGGCCCATTTCAGGACAC -3'
(R):5'- GGGTGTGTGTATATGCATATATGAAC -3'
Posted On2019-06-26