Incidental Mutation 'R7208:Olfr361'
ID560842
Institutional Source Beutler Lab
Gene Symbol Olfr361
Ensembl Gene ENSMUSG00000075378
Gene Nameolfactory receptor 361
SynonymsGA_x6K02T2NLDC-33777519-33776551, MOR159-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7208 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location37083736-37089290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37085658 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 30 (V30A)
Ref Sequence ENSEMBL: ENSMUSP00000149770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100145] [ENSMUST00000214969] [ENSMUST00000216663]
Predicted Effect probably benign
Transcript: ENSMUST00000100145
AA Change: V30A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097723
Gene: ENSMUSG00000075378
AA Change: V30A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-44 PFAM
Pfam:7tm_1 41 289 2.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214969
AA Change: V30A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216663
AA Change: V30A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,630 K854E probably damaging Het
Abcd2 G T 15: 91,190,682 Y309* probably null Het
Ache G A 5: 137,291,489 G360D probably damaging Het
Acot12 T C 13: 91,781,242 L396P probably benign Het
Acox2 T G 14: 8,241,303 D603A probably benign Het
Adam3 C A 8: 24,711,401 K245N probably damaging Het
Ankhd1 T C 18: 36,625,028 I925T probably benign Het
Arhgap27 C T 11: 103,360,759 V48M probably damaging Het
B4galt4 T A 16: 38,753,940 F92Y probably damaging Het
Brwd1 C T 16: 96,035,959 R891Q probably damaging Het
Calcr T C 6: 3,687,612 Q462R probably benign Het
Ccdc112 T C 18: 46,287,631 R351G probably damaging Het
Ccdc80 T G 16: 45,096,710 S610A probably benign Het
Cdh20 C A 1: 104,954,071 N420K possibly damaging Het
Cntn3 G A 6: 102,278,422 R172* probably null Het
Ctnnd1 G T 2: 84,622,046 Q78K possibly damaging Het
D16Ertd472e A T 16: 78,575,926 L41H probably damaging Het
Dmwd C T 7: 19,080,309 H295Y probably benign Het
Dnaic2 T C 11: 114,757,162 V588A unknown Het
Dtx4 C T 19: 12,482,073 probably null Het
Dync2h1 C A 9: 7,141,059 D1323Y probably damaging Het
Fcgbp T A 7: 28,104,021 H1683Q probably benign Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Gm4070 A C 7: 105,902,179 S555R possibly damaging Het
Gm9195 A G 14: 72,451,752 S1876P possibly damaging Het
Grhl2 A C 15: 37,335,736 K431T probably damaging Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gtf2ird1 T C 5: 134,411,094 N94S probably benign Het
Hmgcs1 G T 13: 119,701,084 G195W probably damaging Het
Hrc A T 7: 45,336,565 Y380F possibly damaging Het
Kcnu1 C T 8: 25,919,637 Q863* probably null Het
Lemd2 G A 17: 27,196,191 P300L probably damaging Het
Lnpep A T 17: 17,552,910 Y665* probably null Het
Lrfn1 A G 7: 28,467,139 T653A probably benign Het
Ly6g6c A G 17: 35,067,411 T8A unknown Het
Mcm5 T C 8: 75,121,716 probably null Het
Med28 A T 5: 45,523,452 D86V probably damaging Het
Mup11 A G 4: 60,659,726 S171P possibly damaging Het
Nckap1 A G 2: 80,540,198 F383L probably benign Het
Nid1 G C 13: 13,468,385 G303R probably benign Het
Nkain3 A G 4: 20,282,892 V147A probably benign Het
Pdlim2 T A 14: 70,174,377 I69F probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phf20l1 T C 15: 66,604,789 I245T probably benign Het
Prmt8 C T 6: 127,689,829 R394H possibly damaging Het
Prpf4b T A 13: 34,884,011 D274E unknown Het
Rgs16 T C 1: 153,741,670 L69P probably damaging Het
Robo3 A T 9: 37,424,724 I482N probably damaging Het
Scara3 C T 14: 65,931,266 V301I possibly damaging Het
Serpina1b T A 12: 103,728,294 H397L probably benign Het
Skint11 T A 4: 114,231,747 L246Q probably damaging Het
Skint5 T A 4: 113,539,339 R1212S unknown Het
Slc11a2 T C 15: 100,402,332 D348G probably benign Het
Slc15a2 T C 16: 36,756,281 K495E probably benign Het
Son T G 16: 91,662,102 D2072E unknown Het
Stau1 A G 2: 166,963,574 V34A probably damaging Het
Stk3 G T 15: 35,073,116 L153I possibly damaging Het
Swi5 A T 2: 32,287,910 V13E probably benign Het
Synm T C 7: 67,734,915 M558V probably benign Het
Tep1 T A 14: 50,824,556 probably null Het
Tmc6 A G 11: 117,776,325 V149A probably benign Het
Tmem214 T A 5: 30,870,721 V95E possibly damaging Het
Txlna A G 4: 129,631,278 probably null Het
Vmn2r26 T C 6: 124,061,989 I841T probably damaging Het
Wasf2 G A 4: 133,195,734 V452I probably damaging Het
Wdr62 C T 7: 30,252,336 D673N probably damaging Het
Wdr78 T G 4: 103,066,352 I427L probably benign Het
Wdr95 C T 5: 149,595,371 T559I probably benign Het
Zfat T C 15: 68,180,007 E646G probably benign Het
Other mutations in Olfr361
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Olfr361 APN 2 37085395 missense possibly damaging 0.94
IGL02210:Olfr361 APN 2 37085619 missense possibly damaging 0.54
IGL03180:Olfr361 APN 2 37085710 missense possibly damaging 0.58
R0571:Olfr361 UTSW 2 37085334 missense probably benign 0.00
R1715:Olfr361 UTSW 2 37085176 missense probably damaging 1.00
R1853:Olfr361 UTSW 2 37085220 missense probably damaging 1.00
R2403:Olfr361 UTSW 2 37084974 missense probably benign 0.34
R3009:Olfr361 UTSW 2 37085077 missense probably benign 0.00
R3713:Olfr361 UTSW 2 37085505 missense possibly damaging 0.73
R4355:Olfr361 UTSW 2 37084930 missense probably benign 0.44
R4476:Olfr361 UTSW 2 37085061 missense probably damaging 1.00
R5191:Olfr361 UTSW 2 37084978 missense probably benign 0.00
R5387:Olfr361 UTSW 2 37085719 missense possibly damaging 0.58
R5529:Olfr361 UTSW 2 37084909 missense possibly damaging 0.67
R5891:Olfr361 UTSW 2 37084978 missense probably benign 0.00
R7078:Olfr361 UTSW 2 37085596 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTGTTTACAGAAAGTGTGTGCACC -3'
(R):5'- GCACAGGTTTCACAAGTTCCC -3'

Sequencing Primer
(F):5'- CAGCATCTGGGGAACAATGATAGTTG -3'
(R):5'- CCAATCTGGGATGCAGATACCTG -3'
Posted On2019-06-26