Incidental Mutation 'R7208:Arhgap27'
ID560877
Institutional Source Beutler Lab
Gene Symbol Arhgap27
Ensembl Gene ENSMUSG00000034255
Gene NameRho GTPase activating protein 27
Synonyms5730442P18Rik, Sh3d20, 2310069I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7208 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location103331497-103363692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103360759 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 48 (V48M)
Ref Sequence ENSEMBL: ENSMUSP00000102637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041272] [ENSMUST00000092557] [ENSMUST00000107023] [ENSMUST00000107024] [ENSMUST00000136491]
Predicted Effect probably benign
Transcript: ENSMUST00000041272
SMART Domains Protein: ENSMUSP00000047327
Gene: ENSMUSG00000034247

DomainStartEndE-ValueType
RUN 117 180 3.36e-20 SMART
low complexity region 246 273 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
Blast:DUF4206 448 543 2e-11 BLAST
PH 552 644 2.16e-9 SMART
low complexity region 658 674 N/A INTRINSIC
PH 702 797 2.15e-4 SMART
DUF4206 864 1068 7.51e-103 SMART
C1 1005 1058 2.72e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092557
AA Change: V48M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102637
Gene: ENSMUSG00000034255
AA Change: V48M

DomainStartEndE-ValueType
SH3 9 68 1.59e-1 SMART
low complexity region 73 89 N/A INTRINSIC
low complexity region 220 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107023
SMART Domains Protein: ENSMUSP00000102638
Gene: ENSMUSG00000034255

DomainStartEndE-ValueType
WW 62 95 3.49e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107024
AA Change: V48M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102639
Gene: ENSMUSG00000034255
AA Change: V48M

DomainStartEndE-ValueType
SH3 9 68 1.59e-1 SMART
low complexity region 73 89 N/A INTRINSIC
WW 247 280 3.49e-8 SMART
WW 300 333 7.44e-3 SMART
WW 415 447 2.32e-4 SMART
PH 478 595 1.08e-9 SMART
Blast:RhoGAP 651 682 1e-6 BLAST
RhoGAP 688 863 1.45e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136491
SMART Domains Protein: ENSMUSP00000128051
Gene: ENSMUSG00000034255

DomainStartEndE-ValueType
Blast:WW 52 81 4e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may pay a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,630 K854E probably damaging Het
Abcd2 G T 15: 91,190,682 Y309* probably null Het
Ache G A 5: 137,291,489 G360D probably damaging Het
Acot12 T C 13: 91,781,242 L396P probably benign Het
Acox2 T G 14: 8,241,303 D603A probably benign Het
Adam3 C A 8: 24,711,401 K245N probably damaging Het
Ankhd1 T C 18: 36,625,028 I925T probably benign Het
B4galt4 T A 16: 38,753,940 F92Y probably damaging Het
Brwd1 C T 16: 96,035,959 R891Q probably damaging Het
Calcr T C 6: 3,687,612 Q462R probably benign Het
Ccdc112 T C 18: 46,287,631 R351G probably damaging Het
Ccdc80 T G 16: 45,096,710 S610A probably benign Het
Cdh20 C A 1: 104,954,071 N420K possibly damaging Het
Cntn3 G A 6: 102,278,422 R172* probably null Het
Ctnnd1 G T 2: 84,622,046 Q78K possibly damaging Het
D16Ertd472e A T 16: 78,575,926 L41H probably damaging Het
Dmwd C T 7: 19,080,309 H295Y probably benign Het
Dnaic2 T C 11: 114,757,162 V588A unknown Het
Dtx4 C T 19: 12,482,073 probably null Het
Dync2h1 C A 9: 7,141,059 D1323Y probably damaging Het
Fcgbp T A 7: 28,104,021 H1683Q probably benign Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Gm4070 A C 7: 105,902,179 S555R possibly damaging Het
Gm9195 A G 14: 72,451,752 S1876P possibly damaging Het
Grhl2 A C 15: 37,335,736 K431T probably damaging Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gtf2ird1 T C 5: 134,411,094 N94S probably benign Het
Hmgcs1 G T 13: 119,701,084 G195W probably damaging Het
Hrc A T 7: 45,336,565 Y380F possibly damaging Het
Kcnu1 C T 8: 25,919,637 Q863* probably null Het
Lemd2 G A 17: 27,196,191 P300L probably damaging Het
Lnpep A T 17: 17,552,910 Y665* probably null Het
Lrfn1 A G 7: 28,467,139 T653A probably benign Het
Ly6g6c A G 17: 35,067,411 T8A unknown Het
Mcm5 T C 8: 75,121,716 probably null Het
Med28 A T 5: 45,523,452 D86V probably damaging Het
Mup11 A G 4: 60,659,726 S171P possibly damaging Het
Nckap1 A G 2: 80,540,198 F383L probably benign Het
Nid1 G C 13: 13,468,385 G303R probably benign Het
Nkain3 A G 4: 20,282,892 V147A probably benign Het
Olfr361 A G 2: 37,085,658 V30A probably benign Het
Pdlim2 T A 14: 70,174,377 I69F probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phf20l1 T C 15: 66,604,789 I245T probably benign Het
Prmt8 C T 6: 127,689,829 R394H possibly damaging Het
Prpf4b T A 13: 34,884,011 D274E unknown Het
Rgs16 T C 1: 153,741,670 L69P probably damaging Het
Robo3 A T 9: 37,424,724 I482N probably damaging Het
Scara3 C T 14: 65,931,266 V301I possibly damaging Het
Serpina1b T A 12: 103,728,294 H397L probably benign Het
Skint11 T A 4: 114,231,747 L246Q probably damaging Het
Skint5 T A 4: 113,539,339 R1212S unknown Het
Slc11a2 T C 15: 100,402,332 D348G probably benign Het
Slc15a2 T C 16: 36,756,281 K495E probably benign Het
Son T G 16: 91,662,102 D2072E unknown Het
Stau1 A G 2: 166,963,574 V34A probably damaging Het
Stk3 G T 15: 35,073,116 L153I possibly damaging Het
Swi5 A T 2: 32,287,910 V13E probably benign Het
Synm T C 7: 67,734,915 M558V probably benign Het
Tep1 T A 14: 50,824,556 probably null Het
Tmc6 A G 11: 117,776,325 V149A probably benign Het
Tmem214 T A 5: 30,870,721 V95E possibly damaging Het
Txlna A G 4: 129,631,278 probably null Het
Vmn2r26 T C 6: 124,061,989 I841T probably damaging Het
Wasf2 G A 4: 133,195,734 V452I probably damaging Het
Wdr62 C T 7: 30,252,336 D673N probably damaging Het
Wdr78 T G 4: 103,066,352 I427L probably benign Het
Wdr95 C T 5: 149,595,371 T559I probably benign Het
Zfat T C 15: 68,180,007 E646G probably benign Het
Other mutations in Arhgap27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Arhgap27 APN 11 103333163 missense probably benign 0.00
IGL02946:Arhgap27 APN 11 103338348 missense probably damaging 1.00
IGL03135:Arhgap27 APN 11 103339065 unclassified probably null
R1789:Arhgap27 UTSW 11 103333005 missense probably damaging 1.00
R1842:Arhgap27 UTSW 11 103339996 missense probably damaging 0.99
R1906:Arhgap27 UTSW 11 103332925 missense probably damaging 1.00
R2884:Arhgap27 UTSW 11 103360843 unclassified probably null
R2885:Arhgap27 UTSW 11 103360843 unclassified probably null
R3157:Arhgap27 UTSW 11 103333837 splice site probably null
R4679:Arhgap27 UTSW 11 103360949 unclassified probably benign
R4708:Arhgap27 UTSW 11 103333562 splice site probably benign
R4926:Arhgap27 UTSW 11 103339123 splice site probably null
R5980:Arhgap27 UTSW 11 103356269 missense probably benign 0.00
R6212:Arhgap27 UTSW 11 103360872 missense probably damaging 1.00
R7205:Arhgap27 UTSW 11 103344541 missense probably benign 0.00
R7212:Arhgap27 UTSW 11 103360755 missense probably damaging 0.99
R7327:Arhgap27 UTSW 11 103360541 nonsense probably null
X0028:Arhgap27 UTSW 11 103333028 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACATTCTCCGAGTCGCTAGG -3'
(R):5'- CTTGTTGCCTGCAGAAAAGC -3'

Sequencing Primer
(F):5'- ACGCTGGAGGCCTTGAAGTG -3'
(R):5'- CCTGCAGAAAAGCGCGGTG -3'
Posted On2019-06-26