Incidental Mutation 'R7209:Atg4b'
ID560912
Institutional Source Beutler Lab
Gene Symbol Atg4b
Ensembl Gene ENSMUSG00000026280
Gene Nameautophagy related 4B, cysteine peptidase
Synonyms2510009N07Rik, autophagin 1, Apg4b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7209 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93751500-93790610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93775233 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 128 (I128M)
Ref Sequence ENSEMBL: ENSMUSP00000027502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027502] [ENSMUST00000149436] [ENSMUST00000185482] [ENSMUST00000187824]
Predicted Effect probably damaging
Transcript: ENSMUST00000027502
AA Change: I128M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027502
Gene: ENSMUSG00000026280
AA Change: I128M

DomainStartEndE-ValueType
Pfam:Peptidase_C54 39 335 4.4e-104 PFAM
low complexity region 375 393 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000149436
AA Change: I131M

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123383
Gene: ENSMUSG00000026280
AA Change: I131M

DomainStartEndE-ValueType
Pfam:Peptidase_C54 42 150 6.9e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185482
AA Change: I128M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140758
Gene: ENSMUSG00000026280
AA Change: I128M

DomainStartEndE-ValueType
Pfam:Peptidase_C54 36 137 2.3e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187824
AA Change: I95M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139541
Gene: ENSMUSG00000026280
AA Change: I95M

DomainStartEndE-ValueType
Pfam:Peptidase_C54 61 121 1.5e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased autophagy, impaired swimming, circling, head tilting, and abnormal utricle, saccular, and otolith morphology. Mice homozygous for another gene trap allele exhibit partial preweaning lethality and impaired motor coordination and learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
4933428G20Rik G C 11: 97,492,447 probably null Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Atg4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Atg4b APN 1 93785904 splice site probably benign
IGL01875:Atg4b APN 1 93778310 missense probably damaging 1.00
IGL02884:Atg4b APN 1 93787715 utr 3 prime probably benign
R0050:Atg4b UTSW 1 93787718 utr 3 prime probably benign
R0050:Atg4b UTSW 1 93787718 utr 3 prime probably benign
R0387:Atg4b UTSW 1 93786556 missense probably benign 0.02
R0533:Atg4b UTSW 1 93784910 splice site probably benign
R2382:Atg4b UTSW 1 93784842 missense probably damaging 1.00
R3113:Atg4b UTSW 1 93775704 splice site probably benign
R3730:Atg4b UTSW 1 93768275 missense probably damaging 0.99
R4303:Atg4b UTSW 1 93768262 missense probably benign 0.02
R4612:Atg4b UTSW 1 93786541 missense probably damaging 1.00
R5027:Atg4b UTSW 1 93786575 missense probably benign 0.00
R5048:Atg4b UTSW 1 93775658 missense possibly damaging 0.75
R5427:Atg4b UTSW 1 93775206 missense probably damaging 1.00
R5735:Atg4b UTSW 1 93773797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATCTGAATATTGAACACTGTGC -3'
(R):5'- CTGCACAGAGTCACTCACTG -3'

Sequencing Primer
(F):5'- ACTGTGCAAGTGGAAGGTTTG -3'
(R):5'- TCACTCACTGCAGGCTGTACAG -3'
Posted On2019-06-26