Incidental Mutation 'R7209:Dhx9'
ID560914
Institutional Source Beutler Lab
Gene Symbol Dhx9
Ensembl Gene ENSMUSG00000042699
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 9
Synonymsleukophysin, Ddx9, RNA helicase, nuclear DNA helicase II, NDHII, NDH II, RHA
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7209 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location153455758-153487660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153464623 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 710 (T710A)
Ref Sequence ENSEMBL: ENSMUSP00000139827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042141] [ENSMUST00000186380] [ENSMUST00000186966] [ENSMUST00000188345]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042141
AA Change: T710A

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038135
Gene: ENSMUSG00000042699
AA Change: T710A

DomainStartEndE-ValueType
DSRM 4 70 2.23e-17 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 3.52e-15 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 1.61e-25 SMART
low complexity region 592 608 N/A INTRINSIC
HELICc 667 772 4.69e-18 SMART
HA2 834 922 1.33e-24 SMART
Pfam:OB_NTP_bind 961 1077 1.6e-18 PFAM
low complexity region 1173 1309 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1339 1384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186380
AA Change: T709A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139825
Gene: ENSMUSG00000042699
AA Change: T709A

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 388 575 6.6e-28 SMART
low complexity region 591 607 N/A INTRINSIC
HELICc 666 771 1.9e-20 SMART
HA2 833 921 9.9e-29 SMART
Pfam:OB_NTP_bind 960 1076 5e-13 PFAM
low complexity region 1172 1308 N/A INTRINSIC
low complexity region 1312 1336 N/A INTRINSIC
low complexity region 1338 1383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186966
SMART Domains Protein: ENSMUSP00000139806
Gene: ENSMUSG00000042699

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
Blast:DEXDc 349 451 1e-37 BLAST
PDB:3LLM|B 349 456 2e-55 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000188345
AA Change: T710A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139827
Gene: ENSMUSG00000042699
AA Change: T710A

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 2.1e-17 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 6.6e-28 SMART
low complexity region 592 608 N/A INTRINSIC
Pfam:Helicase_C 678 735 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190544
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes die in embryonic stages with massive apoptotic cell death in embryonic ectodermal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
4933428G20Rik G C 11: 97,492,447 probably null Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Dhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Dhx9 APN 1 153465748 missense probably damaging 1.00
IGL01284:Dhx9 APN 1 153464898 missense probably damaging 1.00
IGL01555:Dhx9 APN 1 153459566 missense probably damaging 1.00
IGL01767:Dhx9 APN 1 153468868 splice site probably benign
IGL02938:Dhx9 APN 1 153464630 missense probably benign 0.37
R0001:Dhx9 UTSW 1 153462636 missense probably damaging 1.00
R0046:Dhx9 UTSW 1 153472707 missense probably benign 0.27
R0309:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R0517:Dhx9 UTSW 1 153478916 missense possibly damaging 0.93
R0589:Dhx9 UTSW 1 153472291 missense probably damaging 1.00
R1217:Dhx9 UTSW 1 153458363 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1430:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R1456:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R1460:Dhx9 UTSW 1 153465680 missense probably benign 0.01
R1724:Dhx9 UTSW 1 153458488 missense probably benign 0.00
R1848:Dhx9 UTSW 1 153465753 missense probably damaging 0.99
R1922:Dhx9 UTSW 1 153460274 splice site probably null
R2001:Dhx9 UTSW 1 153456111 nonsense probably null
R3084:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3085:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3123:Dhx9 UTSW 1 153465706 missense possibly damaging 0.90
R3730:Dhx9 UTSW 1 153478120 missense probably benign 0.16
R4274:Dhx9 UTSW 1 153468926 missense probably damaging 1.00
R4353:Dhx9 UTSW 1 153471789 missense probably damaging 1.00
R4560:Dhx9 UTSW 1 153467157 missense probably damaging 1.00
R4583:Dhx9 UTSW 1 153460303 missense probably damaging 0.98
R4598:Dhx9 UTSW 1 153467051 frame shift probably null
R4603:Dhx9 UTSW 1 153467051 frame shift probably null
R4889:Dhx9 UTSW 1 153481149 missense probably damaging 1.00
R4931:Dhx9 UTSW 1 153472673 missense probably benign 0.02
R5411:Dhx9 UTSW 1 153481223 missense probably benign 0.27
R5569:Dhx9 UTSW 1 153467092 missense possibly damaging 0.83
R5635:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R5659:Dhx9 UTSW 1 153471735 missense probably damaging 1.00
R6128:Dhx9 UTSW 1 153478089 missense probably damaging 1.00
R6215:Dhx9 UTSW 1 153472463 missense probably damaging 1.00
R6428:Dhx9 UTSW 1 153456578 unclassified probably benign
R6489:Dhx9 UTSW 1 153456643 unclassified probably benign
R6717:Dhx9 UTSW 1 153473464 intron probably null
R7098:Dhx9 UTSW 1 153465022 missense probably benign
R7226:Dhx9 UTSW 1 153465677 missense probably benign 0.00
R7440:Dhx9 UTSW 1 153481231 missense probably benign
X0066:Dhx9 UTSW 1 153472529 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCTTATAACAATACAGCAACAGG -3'
(R):5'- ACCTGGCTGGAACTTGATTTATAC -3'

Sequencing Primer
(F):5'- AACAATACAGCAACAGGATTAAAAAG -3'
(R):5'- GAAGTCACCGGTATCAGA -3'
Posted On2019-06-26