Incidental Mutation 'R7209:Commd9'
ID560920
Institutional Source Beutler Lab
Gene Symbol Commd9
Ensembl Gene ENSMUSG00000027163
Gene NameCOMM domain containing 9
Synonyms1810029F08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7209 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location101886247-101901646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101895138 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 19 (S19T)
Ref Sequence ENSEMBL: ENSMUSP00000028584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028584]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028584
AA Change: S19T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028584
Gene: ENSMUSG00000027163
AA Change: S19T

DomainStartEndE-ValueType
Pfam:HCaRG 15 194 9e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, neural tube edema, and cardiovascular abnormalities including hemorrhages, heart hypoplasia, focal myocardial wall necrosis and narrowing of the dorsal aortas, and alterations in cranial blood vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
4933428G20Rik G C 11: 97,492,447 probably null Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Commd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Commd9 APN 2 101895156 nonsense probably null
IGL02232:Commd9 APN 2 101900979 missense probably benign 0.34
IGL03109:Commd9 APN 2 101897170 missense probably benign
R1873:Commd9 UTSW 2 101897157 missense probably benign 0.09
R1933:Commd9 UTSW 2 101901031 missense probably damaging 1.00
R3826:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3828:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3829:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3968:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3969:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3970:Commd9 UTSW 2 101897141 missense probably benign 0.18
R4059:Commd9 UTSW 2 101895154 missense possibly damaging 0.93
R4795:Commd9 UTSW 2 101898896 missense probably benign 0.00
R5289:Commd9 UTSW 2 101898894 missense probably benign 0.00
R5426:Commd9 UTSW 2 101898875 missense probably damaging 1.00
R5437:Commd9 UTSW 2 101901028 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTAGAAGTCCAGACTCCCATAG -3'
(R):5'- CTAATAAGTGGTAAGGGCTGTGGC -3'

Sequencing Primer
(F):5'- TAGCATCACAGGACTTGCTG -3'
(R):5'- TGGCTCAGGGCTCTTCTCAG -3'
Posted On2019-06-26