Incidental Mutation 'R7209:Nlrp4b'
ID560936
Institutional Source Beutler Lab
Gene Symbol Nlrp4b
Ensembl Gene ENSMUSG00000034087
Gene NameNLR family, pyrin domain containing 4B
SynonymsNalp4b, Nalp-gamma
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7209 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location10687789-10730168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10710370 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 82 (V82A)
Ref Sequence ENSEMBL: ENSMUSP00000043881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047809] [ENSMUST00000117413] [ENSMUST00000132990]
Predicted Effect probably benign
Transcript: ENSMUST00000047809
AA Change: V82A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000043881
Gene: ENSMUSG00000034087
AA Change: V82A

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 7.9e-40 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117413
AA Change: V82A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113095
Gene: ENSMUSG00000034087
AA Change: V82A

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 3.3e-39 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132990
SMART Domains Protein: ENSMUSP00000115831
Gene: ENSMUSG00000034087

DomainStartEndE-ValueType
low complexity region 153 168 N/A INTRINSIC
LRR 316 343 4.9e0 SMART
LRR 345 372 1.97e0 SMART
LRR 373 400 1.13e-4 SMART
LRR 402 429 1.93e1 SMART
LRR 430 457 1.73e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
4933428G20Rik G C 11: 97,492,447 probably null Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Nlrp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Nlrp4b APN 7 10714955 missense possibly damaging 0.68
IGL01456:Nlrp4b APN 7 10714223 missense probably benign 0.26
IGL01537:Nlrp4b APN 7 10714991 missense probably damaging 1.00
IGL02539:Nlrp4b APN 7 10714428 missense probably damaging 0.96
IGL02730:Nlrp4b APN 7 10714758 missense probably damaging 1.00
IGL02871:Nlrp4b APN 7 10715265 missense probably benign 0.26
IGL03008:Nlrp4b APN 7 10714589 missense probably benign 0.00
IGL03109:Nlrp4b APN 7 10714946 missense probably damaging 1.00
IGL03251:Nlrp4b APN 7 10714500 missense probably benign 0.01
IGL03354:Nlrp4b APN 7 10714538 missense probably damaging 0.99
R0052:Nlrp4b UTSW 7 10725962 nonsense probably null
R0348:Nlrp4b UTSW 7 10715181 missense possibly damaging 0.60
R0564:Nlrp4b UTSW 7 10714658 missense probably benign 0.15
R0573:Nlrp4b UTSW 7 10714215 missense probably benign 0.01
R0581:Nlrp4b UTSW 7 10714530 missense probably damaging 1.00
R1201:Nlrp4b UTSW 7 10715436 missense possibly damaging 0.64
R1541:Nlrp4b UTSW 7 10725052 missense possibly damaging 0.91
R1771:Nlrp4b UTSW 7 10718593 missense probably damaging 0.96
R1781:Nlrp4b UTSW 7 10715339 missense probably benign 0.13
R1833:Nlrp4b UTSW 7 10725936 missense probably benign 0.00
R2405:Nlrp4b UTSW 7 10714728 missense probably benign 0.08
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2873:Nlrp4b UTSW 7 10710243 nonsense probably null
R2904:Nlrp4b UTSW 7 10714367 missense probably damaging 1.00
R3410:Nlrp4b UTSW 7 10715529 missense probably damaging 1.00
R3714:Nlrp4b UTSW 7 10714881 missense probably benign 0.04
R3982:Nlrp4b UTSW 7 10714431 missense possibly damaging 0.95
R4668:Nlrp4b UTSW 7 10714733 missense possibly damaging 0.66
R4690:Nlrp4b UTSW 7 10719203 missense probably benign 0.00
R4857:Nlrp4b UTSW 7 10715298 missense probably benign 0.05
R5247:Nlrp4b UTSW 7 10714218 missense probably benign 0.21
R5381:Nlrp4b UTSW 7 10715245 nonsense probably null
R5529:Nlrp4b UTSW 7 10714946 missense possibly damaging 0.91
R5589:Nlrp4b UTSW 7 10715585 missense probably benign 0.34
R5770:Nlrp4b UTSW 7 10715487 missense probably benign 0.00
R5990:Nlrp4b UTSW 7 10714491 missense possibly damaging 0.61
R6049:Nlrp4b UTSW 7 10714713 nonsense probably null
R6329:Nlrp4b UTSW 7 10724920 missense probably benign 0.16
R6377:Nlrp4b UTSW 7 10715412 missense probably benign 0.00
R7107:Nlrp4b UTSW 7 10715217 missense probably damaging 0.96
R7237:Nlrp4b UTSW 7 10715216 missense probably benign 0.12
X0063:Nlrp4b UTSW 7 10729587 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTTTAGACAAAATGGCATCTCTG -3'
(R):5'- ATGTCTGCATGAAGCTGCC -3'

Sequencing Primer
(F):5'- GCTTTATATGGTACTGGAAAGAGC -3'
(R):5'- GAAGCTGCCCCCTTTGTCAAG -3'
Posted On2019-06-26