Incidental Mutation 'R7209:Unc79'
ID560954
Institutional Source Beutler Lab
Gene Symbol Unc79
Ensembl Gene ENSMUSG00000021198
Gene Nameunc-79 homolog (C. elegans)
Synonyms9030205A07Rik, Mlca3
Accession Numbers

Genbank: NM_001081017; MGI: 2684729; Ensembl: ENSMUST00000085079

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7209 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location102948859-103184065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103125624 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1930 (M1930T)
Ref Sequence ENSEMBL: ENSMUSP00000136332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085079] [ENSMUST00000101099] [ENSMUST00000178076] [ENSMUST00000179002]
Predicted Effect probably benign
Transcript: ENSMUST00000085079
AA Change: M1734T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000082156
Gene: ENSMUSG00000021198
AA Change: M1734T

DomainStartEndE-ValueType
Pfam:UNC-79 1 469 3.1e-223 PFAM
low complexity region 732 737 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1428 1440 N/A INTRINSIC
low complexity region 1471 1476 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1490 1504 N/A INTRINSIC
low complexity region 1541 1556 N/A INTRINSIC
low complexity region 1861 1870 N/A INTRINSIC
low complexity region 2237 2246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101099
SMART Domains Protein: ENSMUSP00000098659
Gene: ENSMUSG00000021198

DomainStartEndE-ValueType
Pfam:UNC-79 113 646 1.2e-226 PFAM
low complexity region 909 914 N/A INTRINSIC
low complexity region 1023 1039 N/A INTRINSIC
low complexity region 1145 1154 N/A INTRINSIC
low complexity region 1291 1302 N/A INTRINSIC
low complexity region 1490 1502 N/A INTRINSIC
low complexity region 1605 1617 N/A INTRINSIC
low complexity region 1648 1653 N/A INTRINSIC
low complexity region 1654 1666 N/A INTRINSIC
low complexity region 1667 1681 N/A INTRINSIC
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1999 2008 N/A INTRINSIC
low complexity region 2375 2384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178076
AA Change: M1737T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136888
Gene: ENSMUSG00000021198
AA Change: M1737T

DomainStartEndE-ValueType
Pfam:UNC-79 1 450 4.2e-213 PFAM
low complexity region 713 718 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 1117 1128 N/A INTRINSIC
low complexity region 1316 1328 N/A INTRINSIC
low complexity region 1431 1443 N/A INTRINSIC
low complexity region 1474 1479 N/A INTRINSIC
low complexity region 1480 1492 N/A INTRINSIC
low complexity region 1493 1507 N/A INTRINSIC
low complexity region 1544 1559 N/A INTRINSIC
low complexity region 1864 1873 N/A INTRINSIC
low complexity region 2240 2249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179002
AA Change: M1930T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136332
Gene: ENSMUSG00000021198
AA Change: M1930T

DomainStartEndE-ValueType
Pfam:UNC-79 60 593 1.3e-226 PFAM
low complexity region 856 861 N/A INTRINSIC
low complexity region 970 986 N/A INTRINSIC
low complexity region 1092 1101 N/A INTRINSIC
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1509 1521 N/A INTRINSIC
low complexity region 1624 1636 N/A INTRINSIC
low complexity region 1667 1672 N/A INTRINSIC
low complexity region 1673 1685 N/A INTRINSIC
low complexity region 1686 1700 N/A INTRINSIC
low complexity region 1737 1752 N/A INTRINSIC
low complexity region 2057 2066 N/A INTRINSIC
low complexity region 2433 2442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NALCN channel is responsible for Na(+) leak currents. The protein encoded by this gene, along with UNC80, is an accessory subunit of the NALCN channel that contributes to the Ca(2+) sensitivity of the channel. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation results in lethality within the first week after birth, mostly at P0 or P1. Pups fail to nurse and have no milk in stomachs resulting in weakness, inactivity and no weight gain. [provided by MGI curators]
Allele List at MGI

 All alleles(2) : Targeted, knock-out(1) Chemically induced(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
4933428G20Rik G C 11: 97,492,447 probably null Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Unc79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Unc79 APN 12 103169647 missense possibly damaging 0.68
IGL00835:Unc79 APN 12 103141890 splice site probably benign
IGL00917:Unc79 APN 12 103088507 missense possibly damaging 0.53
IGL01012:Unc79 APN 12 103112455 missense probably damaging 1.00
IGL01121:Unc79 APN 12 103165631 missense probably damaging 0.99
IGL01303:Unc79 APN 12 103161867 missense possibly damaging 0.94
IGL01305:Unc79 APN 12 103001871 missense probably damaging 0.99
IGL01315:Unc79 APN 12 103088521 missense possibly damaging 0.66
IGL01388:Unc79 APN 12 103169759 splice site probably benign
IGL01415:Unc79 APN 12 103108685 missense probably damaging 1.00
IGL01447:Unc79 APN 12 103078918 missense probably damaging 1.00
IGL01655:Unc79 APN 12 103168287 missense probably benign 0.00
IGL01662:Unc79 APN 12 103149020 missense possibly damaging 0.92
IGL01728:Unc79 APN 12 103165684 missense probably damaging 0.98
IGL01767:Unc79 APN 12 103141997 missense probably damaging 1.00
IGL02080:Unc79 APN 12 103001975 missense probably damaging 1.00
IGL02115:Unc79 APN 12 102998674 missense probably damaging 1.00
IGL02176:Unc79 APN 12 102998747 splice site probably null
IGL02186:Unc79 APN 12 103011283 missense probably benign 0.04
IGL02205:Unc79 APN 12 103079001 missense probably damaging 1.00
IGL02337:Unc79 APN 12 103156446 splice site probably benign
IGL02498:Unc79 APN 12 103171578 missense probably damaging 0.99
IGL02508:Unc79 APN 12 103112276 missense probably damaging 0.97
IGL02508:Unc79 APN 12 103112018 splice site probably benign
IGL02557:Unc79 APN 12 103182159 splice site probably benign
IGL02589:Unc79 APN 12 103173496 missense probably damaging 1.00
IGL02611:Unc79 APN 12 103165708 missense probably damaging 0.97
IGL02728:Unc79 APN 12 103122429 missense possibly damaging 0.53
IGL02827:Unc79 APN 12 103074846 missense possibly damaging 0.88
IGL03028:Unc79 APN 12 103173526 missense possibly damaging 0.83
IGL03144:Unc79 APN 12 103042142 missense probably damaging 1.00
IGL03229:Unc79 APN 12 103134539 missense probably damaging 0.99
IGL03269:Unc79 APN 12 103088677 missense probably damaging 1.00
IGL03325:Unc79 APN 12 103169610 missense probably damaging 0.98
pencil-thin UTSW 12 103108781 splice site probably null
sweetpea UTSW 12 103059518 missense probably damaging 1.00
3-1:Unc79 UTSW 12 103072750 nonsense probably null
ANU22:Unc79 UTSW 12 103001871 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0067:Unc79 UTSW 12 103059518 missense probably damaging 1.00
R0067:Unc79 UTSW 12 103059518 missense probably damaging 1.00
R0107:Unc79 UTSW 12 103134525 missense possibly damaging 0.70
R0110:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0128:Unc79 UTSW 12 103088434 splice site probably benign
R0166:Unc79 UTSW 12 103156553 missense probably damaging 1.00
R0208:Unc79 UTSW 12 103092027 missense probably benign 0.00
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0218:Unc79 UTSW 12 103108781 splice site probably null
R0244:Unc79 UTSW 12 103112891 missense probably damaging 1.00
R0305:Unc79 UTSW 12 103113200 missense probably benign 0.18
R0310:Unc79 UTSW 12 103061407 missense probably damaging 1.00
R0325:Unc79 UTSW 12 103171644 missense probably damaging 0.98
R0369:Unc79 UTSW 12 103088772 critical splice donor site probably null
R0450:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0503:Unc79 UTSW 12 103078868 missense probably benign 0.01
R0542:Unc79 UTSW 12 103094178 splice site probably benign
R0845:Unc79 UTSW 12 103173444 splice site probably benign
R0893:Unc79 UTSW 12 102991428 missense probably damaging 1.00
R1078:Unc79 UTSW 12 103074853 missense probably benign 0.03
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1159:Unc79 UTSW 12 103047052 splice site probably benign
R1191:Unc79 UTSW 12 103047012 nonsense probably null
R1307:Unc79 UTSW 12 103070076 missense probably damaging 1.00
R1368:Unc79 UTSW 12 103156513 missense probably damaging 1.00
R1476:Unc79 UTSW 12 103183525 missense probably damaging 1.00
R1650:Unc79 UTSW 12 103112793 missense possibly damaging 0.85
R1777:Unc79 UTSW 12 103112455 missense probably damaging 1.00
R1796:Unc79 UTSW 12 103142746 missense probably damaging 0.99
R1824:Unc79 UTSW 12 103059320 missense probably damaging 1.00
R1830:Unc79 UTSW 12 103134478 missense probably damaging 1.00
R1927:Unc79 UTSW 12 103169692 missense probably damaging 1.00
R1958:Unc79 UTSW 12 102991362 missense probably damaging 1.00
R1958:Unc79 UTSW 12 103074919 missense probably benign 0.19
R1980:Unc79 UTSW 12 103011279 nonsense probably null
R2019:Unc79 UTSW 12 103171571 critical splice acceptor site probably null
R2290:Unc79 UTSW 12 103146366 missense probably damaging 1.00
R2939:Unc79 UTSW 12 102991425 missense probably damaging 1.00
R2962:Unc79 UTSW 12 103095119 missense possibly damaging 0.72
R3176:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3276:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3683:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3684:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3686:Unc79 UTSW 12 103088661 missense probably damaging 1.00
R3760:Unc79 UTSW 12 103092705 missense probably damaging 1.00
R4031:Unc79 UTSW 12 103072759 missense possibly damaging 0.46
R4039:Unc79 UTSW 12 103074949 missense possibly damaging 0.88
R4110:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4113:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4159:Unc79 UTSW 12 103070253 intron probably benign
R4273:Unc79 UTSW 12 103122353 missense probably damaging 0.99
R4292:Unc79 UTSW 12 103183444 missense probably damaging 0.99
R4334:Unc79 UTSW 12 103078974 missense probably benign
R4513:Unc79 UTSW 12 103021760 missense probably damaging 1.00
R4562:Unc79 UTSW 12 102991461 missense probably damaging 1.00
R4576:Unc79 UTSW 12 103001803 splice site probably benign
R4645:Unc79 UTSW 12 103112822 missense probably benign
R4758:Unc79 UTSW 12 103161821 nonsense probably null
R4787:Unc79 UTSW 12 103046998 missense probably damaging 1.00
R4852:Unc79 UTSW 12 103173466 missense probably damaging 0.98
R4883:Unc79 UTSW 12 103094333 missense probably damaging 0.99
R4898:Unc79 UTSW 12 103161820 missense probably damaging 0.99
R4979:Unc79 UTSW 12 103112432 missense probably benign
R5044:Unc79 UTSW 12 103112703 missense probably benign 0.32
R5053:Unc79 UTSW 12 103104748 missense probably damaging 1.00
R5061:Unc79 UTSW 12 103168441 missense possibly damaging 0.94
R5075:Unc79 UTSW 12 103074954 missense possibly damaging 0.63
R5101:Unc79 UTSW 12 103112510 missense probably damaging 1.00
R5236:Unc79 UTSW 12 103094395 critical splice donor site probably null
R5240:Unc79 UTSW 12 103070751 missense probably damaging 0.99
R5383:Unc79 UTSW 12 103104627 missense possibly damaging 0.53
R5461:Unc79 UTSW 12 103112138 missense probably damaging 1.00
R5535:Unc79 UTSW 12 103169703 missense possibly damaging 0.84
R5609:Unc79 UTSW 12 103128268 missense probably benign
R5639:Unc79 UTSW 12 103171572 missense probably damaging 1.00
R5704:Unc79 UTSW 12 103001943 missense probably damaging 1.00
R5923:Unc79 UTSW 12 103112468 missense probably damaging 1.00
R5925:Unc79 UTSW 12 103125730 splice site probably null
R5975:Unc79 UTSW 12 103125626 missense possibly damaging 0.53
R6047:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6156:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6175:Unc79 UTSW 12 103183449 missense probably damaging 0.98
R6292:Unc79 UTSW 12 103142732 missense possibly damaging 0.88
R6313:Unc79 UTSW 12 103112619 missense probably damaging 1.00
R6391:Unc79 UTSW 12 103021010 missense probably damaging 1.00
R6405:Unc79 UTSW 12 103168336 missense probably damaging 0.97
R6416:Unc79 UTSW 12 103131646 missense possibly damaging 0.86
R6467:Unc79 UTSW 12 103173512 missense probably damaging 1.00
R6573:Unc79 UTSW 12 103061388 missense probably damaging 1.00
R6614:Unc79 UTSW 12 102991430 missense probably damaging 1.00
R6654:Unc79 UTSW 12 103079048 missense probably damaging 0.99
R6654:Unc79 UTSW 12 103079049 missense probably damaging 1.00
R6700:Unc79 UTSW 12 103125703 missense possibly damaging 0.92
R6724:Unc79 UTSW 12 103104861 missense probably damaging 1.00
R6819:Unc79 UTSW 12 103142008 missense probably benign 0.12
R6869:Unc79 UTSW 12 103113072 missense probably benign 0.33
R6879:Unc79 UTSW 12 103148787 intron probably null
R6942:Unc79 UTSW 12 103122445 critical splice donor site probably null
R6961:Unc79 UTSW 12 103112915 missense probably damaging 1.00
R6973:Unc79 UTSW 12 102998440 missense possibly damaging 0.86
R6980:Unc79 UTSW 12 103059500 missense probably damaging 1.00
R7124:Unc79 UTSW 12 103061393 missense probably damaging 0.99
R7144:Unc79 UTSW 12 103142626 missense probably benign 0.06
R7197:Unc79 UTSW 12 103112506 missense probably benign
R7232:Unc79 UTSW 12 103134475 missense possibly damaging 0.49
R7304:Unc79 UTSW 12 103063190 missense probably damaging 1.00
R7354:Unc79 UTSW 12 103142702 missense possibly damaging 0.79
R7384:Unc79 UTSW 12 103171578 missense probably benign 0.11
R7400:Unc79 UTSW 12 103104630 missense probably damaging 1.00
X0017:Unc79 UTSW 12 103108261 missense probably damaging 0.99
X0028:Unc79 UTSW 12 102991403 missense probably damaging 1.00
Z1088:Unc79 UTSW 12 103021012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTACTGCCTGCACCACAG -3'
(R):5'- CCTGGACATAACCCACGTTC -3'

Sequencing Primer
(F):5'- CCACAGGCGCATGAAAGGC -3'
(R):5'- CCAGCTGCTGATGTTATG -3'
Posted On2019-06-26