Incidental Mutation 'R7209:Hars'
ID560970
Institutional Source Beutler Lab
Gene Symbol Hars
Ensembl Gene ENSMUSG00000001380
Gene Namehistidyl-tRNA synthetase
SynonymsMMHRS
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R7209 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36766530-36783205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36773540 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 126 (S126P)
Ref Sequence ENSEMBL: ENSMUSP00000001416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001416]
Predicted Effect probably benign
Transcript: ENSMUST00000001416
AA Change: S126P

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000001416
Gene: ENSMUSG00000001380
AA Change: S126P

DomainStartEndE-ValueType
WHEP-TRS 7 60 5.37e-11 SMART
Pfam:tRNA-synt_His 61 389 1.9e-41 PFAM
Pfam:HGTP_anticodon2 404 507 3.3e-12 PFAM
Pfam:HGTP_anticodon 410 501 4.4e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
4933428G20Rik G C 11: 97,492,447 probably null Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Hars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Hars APN 18 36768172 missense probably damaging 1.00
IGL01993:Hars APN 18 36770212 missense probably damaging 1.00
IGL03079:Hars APN 18 36770503 missense probably damaging 1.00
P0040:Hars UTSW 18 36773575 missense probably damaging 0.99
R0542:Hars UTSW 18 36771181 missense probably benign 0.23
R0630:Hars UTSW 18 36771389 missense probably damaging 1.00
R1171:Hars UTSW 18 36771414 missense possibly damaging 0.81
R1711:Hars UTSW 18 36771103 missense probably damaging 1.00
R1744:Hars UTSW 18 36770832 missense probably benign 0.00
R1873:Hars UTSW 18 36767241 missense probably damaging 0.99
R3907:Hars UTSW 18 36782716 missense probably benign 0.00
R5193:Hars UTSW 18 36767305 missense possibly damaging 0.94
R5688:Hars UTSW 18 36772316 missense probably damaging 1.00
R6331:Hars UTSW 18 36771332 missense probably benign 0.19
R6349:Hars UTSW 18 36783054 missense probably benign 0.00
R6416:Hars UTSW 18 36773590 missense possibly damaging 0.95
R7075:Hars UTSW 18 36772355 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TACCCAAAGTCCTTTATCTTGCT -3'
(R):5'- TAGTCACGTTGGAGTAGTAAGTTTT -3'

Sequencing Primer
(F):5'- GTCCTTTATCTTGCTTTAGAGGAAAC -3'
(R):5'- CTTAGTGATAGAGGAATTGCCCACC -3'
Posted On2019-06-26