Incidental Mutation 'R7209:Sipa1'
ID560971
Institutional Source Beutler Lab
Gene Symbol Sipa1
Ensembl Gene ENSMUSG00000056917
Gene Namesignal-induced proliferation associated gene 1
SynonymsSPA-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7209 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5651185-5663707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5654975 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 531 (Y531H)
Ref Sequence ENSEMBL: ENSMUSP00000073618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071857] [ENSMUST00000080824] [ENSMUST00000164304] [ENSMUST00000169854]
Predicted Effect probably damaging
Transcript: ENSMUST00000071857
AA Change: Y531H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073618
Gene: ENSMUSG00000056917
AA Change: Y531H

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 529 7.2e-64 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000080824
AA Change: Y531H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079637
Gene: ENSMUSG00000056917
AA Change: Y531H

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164304
AA Change: Y531H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128208
Gene: ENSMUSG00000056917
AA Change: Y531H

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169854
AA Change: Y531H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132345
Gene: ENSMUSG00000056917
AA Change: Y531H

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a mitogen induced GTPase activating protein (GAP). It exhibits a specific GAP activity for Ras-related regulatory proteins Rap1 and Rap2, but not for Ran or other small GTPases. This protein may also hamper mitogen-induced cell cycle progression when abnormally or prematurely expressed. It is localized to the perinuclear region. Two alternatively spliced variants encoding the same isoform have been characterized to date. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display chronic myelocytic leukemia in either the chronic phase or blast crisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
4933428G20Rik G C 11: 97,492,447 probably null Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Sipa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Sipa1 APN 19 5660978 start codon destroyed probably null 0.79
IGL01837:Sipa1 APN 19 5652071 missense probably damaging 0.98
IGL02858:Sipa1 APN 19 5655708 missense probably damaging 0.99
IGL03024:Sipa1 APN 19 5656161 missense probably damaging 1.00
R0277:Sipa1 UTSW 19 5654065 missense probably benign
R0831:Sipa1 UTSW 19 5660354 missense probably damaging 1.00
R0841:Sipa1 UTSW 19 5654807 missense probably benign 0.06
R1102:Sipa1 UTSW 19 5652754 missense probably benign
R1459:Sipa1 UTSW 19 5651664 missense probably damaging 1.00
R1460:Sipa1 UTSW 19 5651447 missense probably benign
R2422:Sipa1 UTSW 19 5652112 missense possibly damaging 0.47
R3741:Sipa1 UTSW 19 5654857 missense probably damaging 1.00
R3924:Sipa1 UTSW 19 5660379 missense probably benign 0.05
R4231:Sipa1 UTSW 19 5654089 missense probably damaging 1.00
R4525:Sipa1 UTSW 19 5651957 missense probably benign 0.12
R4721:Sipa1 UTSW 19 5660385 missense probably damaging 0.99
R5176:Sipa1 UTSW 19 5659378 missense probably damaging 1.00
R5267:Sipa1 UTSW 19 5655758 missense probably benign 0.10
R5375:Sipa1 UTSW 19 5659612 missense probably damaging 0.99
R5480:Sipa1 UTSW 19 5659630 missense possibly damaging 0.68
R5582:Sipa1 UTSW 19 5654701 missense probably benign 0.00
R6005:Sipa1 UTSW 19 5656201 missense probably damaging 1.00
R6329:Sipa1 UTSW 19 5651489 missense probably damaging 1.00
R6712:Sipa1 UTSW 19 5660819 missense possibly damaging 0.69
R7213:Sipa1 UTSW 19 5660523 missense probably damaging 1.00
X0057:Sipa1 UTSW 19 5654920 nonsense probably null
X0064:Sipa1 UTSW 19 5652736 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGCTGAGATGCCCAACAAGC -3'
(R):5'- ATTGGACACATTCCTCGCC -3'

Sequencing Primer
(F):5'- GGACCGCTCGTTTCAGCTC -3'
(R):5'- AGCCTTCCTCCACGCAG -3'
Posted On2019-06-26