Incidental Mutation 'R7210:Oxct2b'
ID560986
Institutional Source Beutler Lab
Gene Symbol Oxct2b
Ensembl Gene ENSMUSG00000076438
Gene Name3-oxoacid CoA transferase 2B
SynonymsScot-t2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location123116266-123118000 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to C at 123116276 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002457] [ENSMUST00000102648]
Predicted Effect probably benign
Transcript: ENSMUST00000002457
SMART Domains Protein: ENSMUSP00000002457
Gene: ENSMUSG00000002384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 26 248 2.7e-62 PFAM
TGFB 298 399 2.83e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102648
SMART Domains Protein: ENSMUSP00000099708
Gene: ENSMUSG00000076438

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CoA_trans 43 272 2.02e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype NO_PHENOTYPE,Incidence of lethality among homozygous null mutants is variable depending on genetic background and due to allantoic and embryonic abnormalities. Heterozygous and surviving homozygous males exhibit varying degrees of germ cell deficiency and infertility, also background dependent.
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Oxct2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Oxct2b APN 4 123117508 missense probably damaging 1.00
R0504:Oxct2b UTSW 4 123116840 missense possibly damaging 0.92
R0504:Oxct2b UTSW 4 123116912 small deletion probably benign
R0543:Oxct2b UTSW 4 123116989 missense possibly damaging 0.93
R1167:Oxct2b UTSW 4 123117585 missense probably damaging 0.99
R1365:Oxct2b UTSW 4 123117369 missense probably benign
R1891:Oxct2b UTSW 4 123117145 missense probably benign 0.01
R2311:Oxct2b UTSW 4 123117418 missense probably damaging 1.00
R2906:Oxct2b UTSW 4 123117030 missense probably benign 0.12
R4168:Oxct2b UTSW 4 123117685 missense probably damaging 0.96
R4657:Oxct2b UTSW 4 123117133 missense probably damaging 1.00
R6159:Oxct2b UTSW 4 123117451 missense probably damaging 1.00
R6221:Oxct2b UTSW 4 123116808 missense probably damaging 1.00
R6271:Oxct2b UTSW 4 123117715 missense probably damaging 1.00
R6357:Oxct2b UTSW 4 123116916 missense probably benign 0.00
R6389:Oxct2b UTSW 4 123116574 missense probably benign 0.21
R6996:Oxct2b UTSW 4 123117687 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTGTCCAAGGCTCTTGAGAG -3'
(R):5'- TGACGATCTTCAGGTCCTTCAC -3'

Sequencing Primer
(F):5'- GCTCTTGAGAGACAGGCTG -3'
(R):5'- ATGACGGTCGACCCATCCTTG -3'
Posted On2019-06-26