Incidental Mutation 'R7210:Ackr2'
ID561007
Institutional Source Beutler Lab
Gene Symbol Ackr2
Ensembl Gene ENSMUSG00000044534
Gene Nameatypical chemokine receptor 2
SynonymsCcbp2, chemokine decoy receptor D6, D6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location121898355-121911074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121908877 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 106 (A106V)
Ref Sequence ENSEMBL: ENSMUSP00000050119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050327] [ENSMUST00000214340] [ENSMUST00000215664] [ENSMUST00000216326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050327
AA Change: A106V

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050119
Gene: ENSMUSG00000044534
AA Change: A106V

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_1 62 311 1e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214340
AA Change: A106V

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000215664
Predicted Effect probably benign
Transcript: ENSMUST00000216326
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta chemokine receptor, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptor-mediated signal transduction are critical for the recruitment of effector immune cells to the inflammation site. This gene is expressed in a range of tissues and hemopoietic cells. The expression of this receptor in lymphatic endothelial cells and overexpression in vascular tumors suggested its function in chemokine-driven recirculation of leukocytes and possible chemokine effects on the development and growth of vascular tumors. This receptor appears to bind the majority of beta-chemokine family members; however, its specific function remains unknown. This gene is mapped to chromosome 3p21.3, a region that includes a cluster of chemokine receptor genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased inflammatory responses but are viable and fertile without any other gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Ackr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Ackr2 APN 9 121909500 missense probably benign 0.02
IGL01744:Ackr2 APN 9 121909119 missense probably benign 0.06
IGL03019:Ackr2 APN 9 121909182 missense probably benign 0.43
IGL03143:Ackr2 APN 9 121909267 missense probably damaging 1.00
IGL03398:Ackr2 APN 9 121908588 missense probably damaging 1.00
R0180:Ackr2 UTSW 9 121908916 missense probably benign 0.44
R0366:Ackr2 UTSW 9 121909360 missense probably damaging 1.00
R1295:Ackr2 UTSW 9 121908717 missense possibly damaging 0.94
R1596:Ackr2 UTSW 9 121909212 missense probably damaging 1.00
R1827:Ackr2 UTSW 9 121909515 missense probably benign 0.36
R2109:Ackr2 UTSW 9 121908960 missense probably damaging 0.98
R2125:Ackr2 UTSW 9 121908786 nonsense probably null
R2414:Ackr2 UTSW 9 121908974 missense probably damaging 1.00
R4161:Ackr2 UTSW 9 121909522 missense probably benign 0.05
R4524:Ackr2 UTSW 9 121909543 missense probably benign
R4732:Ackr2 UTSW 9 121909183 missense probably damaging 0.98
R4733:Ackr2 UTSW 9 121909183 missense probably damaging 0.98
R5809:Ackr2 UTSW 9 121909474 missense probably damaging 1.00
R7203:Ackr2 UTSW 9 121908967 missense probably damaging 1.00
R7267:Ackr2 UTSW 9 121908808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTGGTTTGCAGGAAGGAC -3'
(R):5'- CAATGAGAAGCAGGTTCCTGAAC -3'

Sequencing Primer
(F):5'- AAGAGTCTTTCTGCCGGTC -3'
(R):5'- AGGTTCCTGAACTGGGCCTTC -3'
Posted On2019-06-26