Mutagenetix > Incidental Mutation

Incidental Mutation 'R7210:Ptrh2'

561015

Institutional Source

Beutler Lab

Gene Symbol

Ptrh2

Ensembl Gene

ENSMUSG00000072582

Gene Name

peptidyl-tRNA hydrolase 2

Synonyms

A230072I16Rik, Bit1

MMRRC Submission

045239-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.806) question?

Stock #

R7210 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86574900-86583283 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86580793 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 137 (T137S)

Ref Sequence

ENSEMBL: ENSMUSP00000103657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060766] [ENSMUST00000103186] [ENSMUST00000108021] [ENSMUST00000108022]

AlphaFold

Q8R2Y8

Predicted Effect

probably benign
Transcript: ENSMUST00000060766

SMART Domains

Protein: ENSMUSP00000050220
Gene: ENSMUSG00000047126

Domain	Start	End	E-Value	Type
Pfam:Clathrin_propel	19	56	5.3e-10	PFAM
Pfam:Clathrin_propel	152	191	1.5e-11	PFAM
Pfam:Clathrin_propel	202	238	1.2e-11	PFAM
Pfam:Clathrin_propel	257	292	2.2e-8	PFAM
Pfam:Clathrin_propel	300	334	8.6e-10	PFAM
Pfam:Clathrin-link	335	358	1.7e-17	PFAM
Pfam:Clathrin_H_link	360	425	7.1e-35	PFAM
low complexity region	449	462	N/A	INTRINSIC
CLH	541	683	1.65e-41	SMART
CLH	690	832	1.24e-45	SMART
CLH	837	976	6.68e-42	SMART
CLH	983	1128	7.21e-47	SMART
CLH	1132	1273	7.91e-44	SMART
CLH	1278	1424	1.59e-48	SMART
CLH	1427	1586	8.36e-43	SMART
low complexity region	1666	1677	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103186

SMART Domains

Protein: ENSMUSP00000099475
Gene: ENSMUSG00000047126

Domain	Start	End	E-Value	Type
Pfam:Clathrin_propel	19	56	2e-7	PFAM
Pfam:Clathrin_propel	148	187	3.8e-9	PFAM
Pfam:Clathrin_propel	198	234	3.8e-9	PFAM
Pfam:Clathrin-link	331	354	3.5e-17	PFAM
Pfam:Clathrin_H_link	356	421	1.9e-35	PFAM
low complexity region	445	458	N/A	INTRINSIC
CLH	537	679	1.65e-41	SMART
CLH	686	828	1.24e-45	SMART
CLH	833	972	6.68e-42	SMART
CLH	979	1124	7.21e-47	SMART
CLH	1128	1269	7.91e-44	SMART
CLH	1274	1420	1.59e-48	SMART
CLH	1423	1582	8.36e-43	SMART
low complexity region	1662	1673	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108021
AA Change: T137S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103656
Gene: ENSMUSG00000072582
AA Change: T137S

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:PTH2	66	181	4.7e-53	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108022
AA Change: T137S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103657
Gene: ENSMUSG00000072582
AA Change: T137S

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:PTH2	67	181	1.9e-51	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial protein with two putative domains, an N-terminal mitochondrial localization sequence, and a UPF0099 domain. In vitro assays suggest that this protein possesses peptidyl-tRNA hydrolase activity, to release the peptidyl moiety from tRNA, thereby preventing the accumulation of dissociated peptidyl-tRNA that could reduce the efficiency of translation. This protein also plays a role regulating cell survival and death. It promotes survival as part of an integrin-signaling pathway for cells attached to the extracellular matrix (ECM), but also promotes apoptosis in cells that have lost their attachment to the ECM, a process called anoikos. After loss of cell attachment to the ECM, this protein is phosphorylated, is released from the mitochondria into the cytosol, and promotes caspase-independent apoptosis through interactions with transcriptional regulators. This gene has been implicated in the development and progression of tumors, and mutations in this gene have been associated with an infantile multisystem neurologic, endocrine, and pancreatic disease (INMEPD) characterized by intellectual disability, postnatal microcephaly, progressive cerebellar atrophy, hearing impairment, polyneuropathy, failure to thrive, and organ fibrosis with exocrine pancreas insufficiency (PMID: 25574476). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display neutropenia, delayed kidney and muscle development, and postnatal death due to a runting syndrome associated with progressive muscle weakness, ataxia, and decreased weight. Cultured mouse embryonic fibroblasts show increased resistance to anoikis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	G	A	11: 94,264,767 (GRCm39)	P194S	probably benign	Het
Ackr2	C	T	9: 121,737,943 (GRCm39)	A106V	possibly damaging	Het
Alg3	G	A	16: 20,424,644 (GRCm39)	P112L	unknown	Het
Areg	T	A	5: 91,288,764 (GRCm39)	Y23*	probably null	Het
Aspn	A	G	13: 49,719,967 (GRCm39)	T328A	probably benign	Het
B020011L13Rik	A	T	1: 117,729,241 (GRCm39)	E249D	possibly damaging	Het
Bptf	G	A	11: 106,945,290 (GRCm39)	Q2650*	probably null	Het
Btbd3	A	T	2: 138,125,664 (GRCm39)	R283W	probably damaging	Het
Cep131	T	C	11: 119,955,615 (GRCm39)	H1035R	probably damaging	Het
Cfap57	A	T	4: 118,433,900 (GRCm39)	Y959*	probably null	Het
Cnot1	T	C	8: 96,515,286 (GRCm39)	Y25C	probably damaging	Het
Crebbp	G	A	16: 3,902,121 (GRCm39)	H2373Y	possibly damaging	Het
Ctnna3	T	C	10: 64,086,547 (GRCm39)	L373P	probably damaging	Het
Cyp8b1	T	A	9: 121,744,246 (GRCm39)	D362V	probably damaging	Het
D630003M21Rik	T	A	2: 158,057,932 (GRCm39)		probably null	Het
Dpp6	T	C	5: 27,803,801 (GRCm39)	I249T	probably damaging	Het
Fam149b	T	G	14: 20,428,540 (GRCm39)	I475M	probably damaging	Het
Fat1	A	G	8: 45,476,540 (GRCm39)	Y1862C	probably damaging	Het
Fcrl5	A	T	3: 87,353,719 (GRCm39)	N355Y	possibly damaging	Het
Fgd6	C	T	10: 93,969,954 (GRCm39)	T1201I	probably damaging	Het
Fndc8	A	T	11: 82,788,692 (GRCm39)	D174V	probably damaging	Het
Gatb	A	G	3: 85,481,527 (GRCm39)	H26R	probably benign	Het
Gm37240	T	A	3: 84,405,114 (GRCm39)	T230S	probably benign	Het
Gria4	T	C	9: 4,464,135 (GRCm39)	Q609R	probably damaging	Het
Gse1	C	A	8: 120,957,441 (GRCm39)	T644K	unknown	Het
Ifit1bl1	T	G	19: 34,571,564 (GRCm39)	I298L	probably benign	Het
Il31ra	T	C	13: 112,686,034 (GRCm39)	D85G	possibly damaging	Het
Katnip	T	C	7: 125,471,411 (GRCm39)	V1504A	probably damaging	Het
Lyst	T	C	13: 13,831,568 (GRCm39)	L1664P	probably damaging	Het
Mrpl35	A	G	6: 71,794,722 (GRCm39)	L82S	possibly damaging	Het
Myo7b	G	A	18: 32,140,155 (GRCm39)	R212C	probably damaging	Het
Myom2	T	C	8: 15,154,114 (GRCm39)	V684A	probably damaging	Het
Nbeal1	G	C	1: 60,276,310 (GRCm39)	V684L	probably benign	Het
Nop58	G	T	1: 59,749,539 (GRCm39)		probably null	Het
Nudt13	T	A	14: 20,359,852 (GRCm39)	I193N	possibly damaging	Het
Nyap1	C	A	5: 137,736,244 (GRCm39)	R81L	probably damaging	Het
Or1e28-ps1	T	C	11: 73,615,699 (GRCm39)	I50M	possibly damaging	Het
Oxct2b	A	C	4: 123,010,069 (GRCm39)		probably benign	Het
Pcf11	C	T	7: 92,312,684 (GRCm39)	A230T	probably benign	Het
Phactr4	A	T	4: 132,085,582 (GRCm39)	*695R	probably null	Het
Pkd1	T	C	17: 24,794,840 (GRCm39)	S2176P	probably damaging	Het
Plch2	C	A	4: 155,093,543 (GRCm39)	R133L	probably damaging	Het
Ptprq	G	T	10: 107,521,032 (GRCm39)	N713K	probably damaging	Het
R3hdm1	A	G	1: 128,138,945 (GRCm39)	Y718C	possibly damaging	Het
Rftn1	T	A	17: 50,301,335 (GRCm39)	R505*	probably null	Het
Rps15a	A	G	7: 117,708,334 (GRCm39)	F128L	probably benign	Het
Slc25a25	A	T	2: 32,310,408 (GRCm39)	M177K	possibly damaging	Het
Smgc	C	A	15: 91,744,492 (GRCm39)	P631Q	probably damaging	Het
Sox2	T	C	3: 34,705,306 (GRCm39)	S248P	probably damaging	Het
Sycp1	T	C	3: 102,760,808 (GRCm39)	K702E	probably damaging	Het
Tes	G	T	6: 17,104,761 (GRCm39)	C414F	probably damaging	Het
Tet1	A	T	10: 62,650,280 (GRCm39)	C14S	probably null	Het
Tle3	C	T	9: 61,319,587 (GRCm39)	P452S	probably damaging	Het
Tmc6	A	C	11: 117,666,670 (GRCm39)	L131R	possibly damaging	Het
Tnip3	C	T	6: 65,570,495 (GRCm39)	R30*	probably null	Het
Tnrc6b	G	T	15: 80,813,486 (GRCm39)	G1748W	probably damaging	Het
Ugt2b38	T	G	5: 87,558,284 (GRCm39)	D459A	probably damaging	Het
Zdhhc2	A	T	8: 40,920,480 (GRCm39)	R246S	probably damaging	Het
Zscan22	T	A	7: 12,640,748 (GRCm39)	C331S	probably damaging	Het

Other mutations in Ptrh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02008:Ptrh2	APN	11	86,580,592 (GRCm39)	missense	probably benign	0.05
R4774:Ptrh2	UTSW	11	86,580,833 (GRCm39)	missense	probably damaging	1.00
R4869:Ptrh2	UTSW	11	86,580,631 (GRCm39)	nonsense	probably null
R4928:Ptrh2	UTSW	11	86,580,862 (GRCm39)	missense	probably damaging	1.00
R7192:Ptrh2	UTSW	11	86,580,835 (GRCm39)	missense	probably damaging	1.00
R8835:Ptrh2	UTSW	11	86,580,412 (GRCm39)	missense	probably damaging	0.97
R8992:Ptrh2	UTSW	11	86,580,907 (GRCm39)	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- TGAAGCAAGCATCTTGGGAG -3'
(R):5'- TCGGACAGAATCTCCATCAAG -3'

Sequencing Primer
(F):5'- GTGGTTCGAACTGACCTTAAAATGG -3'
(R):5'- TCTCCATCAAGCAAAAGCTTATCTAG -3'

Posted On

2019-06-26