Incidental Mutation 'R7210:Ptrh2'
ID561015
Institutional Source Beutler Lab
Gene Symbol Ptrh2
Ensembl Gene ENSMUSG00000072582
Gene Namepeptidyl-tRNA hydrolase 2
SynonymsBit1, A230072I16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location86683985-86692457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86689967 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 137 (T137S)
Ref Sequence ENSEMBL: ENSMUSP00000103657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060766] [ENSMUST00000103186] [ENSMUST00000108021] [ENSMUST00000108022]
Predicted Effect probably benign
Transcript: ENSMUST00000060766
SMART Domains Protein: ENSMUSP00000050220
Gene: ENSMUSG00000047126

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 5.3e-10 PFAM
Pfam:Clathrin_propel 152 191 1.5e-11 PFAM
Pfam:Clathrin_propel 202 238 1.2e-11 PFAM
Pfam:Clathrin_propel 257 292 2.2e-8 PFAM
Pfam:Clathrin_propel 300 334 8.6e-10 PFAM
Pfam:Clathrin-link 335 358 1.7e-17 PFAM
Pfam:Clathrin_H_link 360 425 7.1e-35 PFAM
low complexity region 449 462 N/A INTRINSIC
CLH 541 683 1.65e-41 SMART
CLH 690 832 1.24e-45 SMART
CLH 837 976 6.68e-42 SMART
CLH 983 1128 7.21e-47 SMART
CLH 1132 1273 7.91e-44 SMART
CLH 1278 1424 1.59e-48 SMART
CLH 1427 1586 8.36e-43 SMART
low complexity region 1666 1677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103186
SMART Domains Protein: ENSMUSP00000099475
Gene: ENSMUSG00000047126

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 2e-7 PFAM
Pfam:Clathrin_propel 148 187 3.8e-9 PFAM
Pfam:Clathrin_propel 198 234 3.8e-9 PFAM
Pfam:Clathrin-link 331 354 3.5e-17 PFAM
Pfam:Clathrin_H_link 356 421 1.9e-35 PFAM
low complexity region 445 458 N/A INTRINSIC
CLH 537 679 1.65e-41 SMART
CLH 686 828 1.24e-45 SMART
CLH 833 972 6.68e-42 SMART
CLH 979 1124 7.21e-47 SMART
CLH 1128 1269 7.91e-44 SMART
CLH 1274 1420 1.59e-48 SMART
CLH 1423 1582 8.36e-43 SMART
low complexity region 1662 1673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108021
AA Change: T137S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103656
Gene: ENSMUSG00000072582
AA Change: T137S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:PTH2 66 181 4.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108022
AA Change: T137S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103657
Gene: ENSMUSG00000072582
AA Change: T137S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:PTH2 67 181 1.9e-51 PFAM
Meta Mutation Damage Score 0.1592 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial protein with two putative domains, an N-terminal mitochondrial localization sequence, and a UPF0099 domain. In vitro assays suggest that this protein possesses peptidyl-tRNA hydrolase activity, to release the peptidyl moiety from tRNA, thereby preventing the accumulation of dissociated peptidyl-tRNA that could reduce the efficiency of translation. This protein also plays a role regulating cell survival and death. It promotes survival as part of an integrin-signaling pathway for cells attached to the extracellular matrix (ECM), but also promotes apoptosis in cells that have lost their attachment to the ECM, a process called anoikos. After loss of cell attachment to the ECM, this protein is phosphorylated, is released from the mitochondria into the cytosol, and promotes caspase-independent apoptosis through interactions with transcriptional regulators. This gene has been implicated in the development and progression of tumors, and mutations in this gene have been associated with an infantile multisystem neurologic, endocrine, and pancreatic disease (INMEPD) characterized by intellectual disability, postnatal microcephaly, progressive cerebellar atrophy, hearing impairment, polyneuropathy, failure to thrive, and organ fibrosis with exocrine pancreas insufficiency (PMID: 25574476). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display neutropenia, delayed kidney and muscle development, and postnatal death due to a runting syndrome associated with progressive muscle weakness, ataxia, and decreased weight. Cultured mouse embryonic fibroblasts show increased resistance to anoikis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Ptrh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Ptrh2 APN 11 86689766 missense probably benign 0.05
R4774:Ptrh2 UTSW 11 86690007 missense probably damaging 1.00
R4869:Ptrh2 UTSW 11 86689805 nonsense probably null
R4928:Ptrh2 UTSW 11 86690036 missense probably damaging 1.00
R7192:Ptrh2 UTSW 11 86690009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCAAGCATCTTGGGAG -3'
(R):5'- TCGGACAGAATCTCCATCAAG -3'

Sequencing Primer
(F):5'- GTGGTTCGAACTGACCTTAAAATGG -3'
(R):5'- TCTCCATCAAGCAAAAGCTTATCTAG -3'
Posted On2019-06-26