Incidental Mutation 'R7210:Cep131'
ID561018
Institutional Source Beutler Lab
Gene Symbol Cep131
Ensembl Gene ENSMUSG00000039781
Gene Namecentrosomal protein 131
SynonymsAzi1, AZ1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120064430-120086827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120064789 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1035 (H1035R)
Ref Sequence ENSEMBL: ENSMUSP00000101836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106227] [ENSMUST00000106229] [ENSMUST00000180242]
Predicted Effect probably damaging
Transcript: ENSMUST00000106227
AA Change: H1034R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101834
Gene: ENSMUSG00000039781
AA Change: H1034R

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 344 N/A INTRINSIC
low complexity region 395 409 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
SCOP:d1jila_ 672 756 2e-3 SMART
low complexity region 785 803 N/A INTRINSIC
low complexity region 813 826 N/A INTRINSIC
coiled coil region 874 1053 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106229
AA Change: H1035R

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101836
Gene: ENSMUSG00000039781
AA Change: H1035R

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 342 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180242
AA Change: H1035R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136392
Gene: ENSMUSG00000039781
AA Change: H1035R

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 345 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: The protein encoding this gene is a centriolar satellite protein that localizes around the basal body via transport along microtubules. Knockdown in mouse fibroblasts results in a reduction in ciliogenesis. Null mutant mice display no discernible ciliary phenotypes and embryonic patterning and adult homeostasis are largely unaffected. Male mice are infertile, however, due to defects in microtubule trafficking in the sperm manchette and flagella. In addition, the protein binds to a complex of proteins associated with Bardet-Biedl syndrome called the BBSome, and depletion of this protein results in an accumulation of the BBSome in cilia. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit partial preweaning lethality with no apparent defects in cilia formation or function. However, homozygotes display complete male infertility associated with spermiogenesis arrest, severe flagellar defects, and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Cep131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Cep131 APN 11 120077009 missense possibly damaging 0.55
IGL01522:Cep131 APN 11 120067163 missense probably benign 0.09
IGL01524:Cep131 APN 11 120065960 missense probably damaging 1.00
IGL02477:Cep131 APN 11 120070580 missense probably damaging 1.00
R0565:Cep131 UTSW 11 120073762 missense probably damaging 0.97
R1731:Cep131 UTSW 11 120076916 splice site probably null
R1739:Cep131 UTSW 11 120083906 missense probably benign 0.01
R1797:Cep131 UTSW 11 120073736 splice site probably null
R2444:Cep131 UTSW 11 120070495 missense probably damaging 1.00
R2899:Cep131 UTSW 11 120072028 missense probably benign 0.01
R3854:Cep131 UTSW 11 120067185 nonsense probably null
R3856:Cep131 UTSW 11 120067185 nonsense probably null
R4446:Cep131 UTSW 11 120064819 missense probably damaging 1.00
R4624:Cep131 UTSW 11 120070832 missense probably damaging 1.00
R4838:Cep131 UTSW 11 120076156 missense probably damaging 1.00
R4892:Cep131 UTSW 11 120068057 missense probably damaging 0.99
R5170:Cep131 UTSW 11 120070609 missense probably damaging 0.99
R6128:Cep131 UTSW 11 120065975 missense probably damaging 1.00
R6179:Cep131 UTSW 11 120066011 missense probably benign 0.13
R6362:Cep131 UTSW 11 120064690 missense probably damaging 0.99
R6630:Cep131 UTSW 11 120073815 missense probably damaging 1.00
R6786:Cep131 UTSW 11 120065392 missense probably damaging 1.00
R6846:Cep131 UTSW 11 120065691 missense probably damaging 1.00
R6847:Cep131 UTSW 11 120065691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGGCGATGTCACTTAG -3'
(R):5'- ACATGAGAATGAGACTTCCACC -3'

Sequencing Primer
(F):5'- GAACTCAGAGATGACCCTTTGTG -3'
(R):5'- CAAAAACCACCTTAGGGTCTGGTTG -3'
Posted On2019-06-26