Incidental Mutation 'R7211:Nbeal1'
ID561032
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Nameneurobeachin like 1
SynonymsA530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
Accession Numbers

Genbank: NM_173444; MGI: 2444343

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7211 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location60180599-60338328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 60200951 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 159 (L159V)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834]
Predicted Effect probably damaging
Transcript: ENSMUST00000160834
AA Change: L159V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: L159V

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G T 9: 51,290,433 Q108K probably damaging Het
9930021J03Rik A G 19: 29,786,312 F121S Het
a T A 2: 155,045,779 V53E probably damaging Het
A1cf A G 19: 31,927,141 Y268C probably benign Het
Adamts13 C T 2: 26,989,298 T621I probably benign Het
AI464131 A G 4: 41,498,028 I534T probably damaging Het
Akr1b7 A T 6: 34,421,114 N293Y probably benign Het
Angpt2 T A 8: 18,741,131 T50S probably benign Het
Anks1b C A 10: 90,511,070 A744D possibly damaging Het
Aqr A G 2: 114,134,723 V587A probably benign Het
Atm A G 9: 53,488,560 V1540A probably benign Het
BC022687 T A 12: 112,811,012 probably null Het
C4b A G 17: 34,735,534 V887A possibly damaging Het
Cd200r1 A G 16: 44,788,757 T26A probably benign Het
Ciao1 A G 2: 127,247,008 probably null Het
Clca3a2 A G 3: 144,814,014 C200R probably benign Het
Col6a5 T A 9: 105,928,164 Q1181L unknown Het
Copb2 T A 9: 98,574,145 I244N probably damaging Het
Cpb2 A G 14: 75,274,990 Y281C probably damaging Het
Disp3 C A 4: 148,241,522 V1260F probably damaging Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
Dpysl2 T C 14: 66,829,976 N162S probably damaging Het
Dsp T A 13: 38,188,535 probably null Het
Epm2a T C 10: 11,343,675 Y69H probably benign Het
Frzb C A 2: 80,418,325 E262* probably null Het
Gaa T C 11: 119,284,204 V877A possibly damaging Het
Gm11639 C A 11: 104,710,713 A284D probably benign Het
Gm11639 G T 11: 104,724,609 probably null Het
Gm5346 T A 8: 43,625,877 S437C probably damaging Het
Gpnmb T C 6: 49,052,015 I489T possibly damaging Het
Gpr31b T C 17: 13,052,217 T22A probably benign Het
Gys1 T A 7: 45,448,260 F477Y possibly damaging Het
Hoxc11 A C 15: 102,955,052 E176A possibly damaging Het
Kcnk13 T A 12: 100,061,817 F384I probably damaging Het
Ky A G 9: 102,509,150 E59G probably benign Het
Lama4 T A 10: 39,005,495 D93E probably damaging Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Lrrc71 G T 3: 87,743,326 Q210K possibly damaging Het
Map1a G A 2: 121,304,643 R1980H probably benign Het
Med15 T C 16: 17,698,113 D15G unknown Het
Mfng A T 15: 78,773,068 S69T probably benign Het
Muc16 T G 9: 18,498,570 S181R probably damaging Het
Mug1 A T 6: 121,880,539 Q1074L possibly damaging Het
Nbea T A 3: 56,004,901 N1155I probably benign Het
Nudt1 C A 5: 140,337,647 P118Q possibly damaging Het
Olfr450 A T 6: 42,818,016 T182S probably benign Het
Olfr970 A C 9: 39,819,858 Q73P possibly damaging Het
Pcdhga6 T A 18: 37,709,120 V631D probably benign Het
Pcna A C 2: 132,249,872 V203G probably damaging Het
Pgf G T 12: 85,175,775 N33K probably benign Het
Pgm1 T C 5: 64,105,850 L280P probably damaging Het
Plcg1 G A 2: 160,731,874 A20T probably benign Het
Prdx5 G T 19: 6,907,590 D126E probably damaging Het
Prkag2 T C 5: 24,995,298 T20A probably benign Het
Prr14l T A 5: 32,830,087 Q688L probably damaging Het
Pxdn T G 12: 29,984,904 D253E possibly damaging Het
Rbm18 A T 2: 36,122,893 C53* probably null Het
Rprm A T 2: 54,085,258 L16Q probably benign Het
Saysd1 A G 14: 20,077,508 F116S probably damaging Het
Scg3 A G 9: 75,682,084 S96P probably benign Het
Scgb1b3 C T 7: 31,375,653 L16F unknown Het
Sh3tc2 A G 18: 61,989,403 T412A probably benign Het
Skint6 T C 4: 113,238,369 N31S probably benign Het
Slc22a2 T C 17: 12,586,883 probably null Het
Slc8a2 C T 7: 16,140,613 T262I possibly damaging Het
Smarcc1 A T 9: 110,150,014 K188N probably damaging Het
Srrm1 CGAGGAGGAGGAGG CGAGGAGGAGG 4: 135,327,128 probably benign Het
Taf6 T C 5: 138,178,826 T660A possibly damaging Het
Tbx2 C T 11: 85,834,714 R164C probably damaging Het
Tec T C 5: 72,782,012 D220G probably null Het
Tfec A T 6: 16,867,465 W59R probably damaging Het
Tmtc2 G T 10: 105,573,726 S8R probably benign Het
Tmtc3 A T 10: 100,447,605 M696K probably benign Het
Trpc3 A T 3: 36,640,733 S691T possibly damaging Het
Ttf2 A T 3: 100,959,307 M503K probably benign Het
Ttll7 A G 3: 146,913,276 H312R probably damaging Het
Ttn T C 2: 76,767,688 Y19627C probably damaging Het
Ugt2b35 T C 5: 87,001,318 S143P probably benign Het
Usp53 A G 3: 122,957,650 S253P probably damaging Het
Utp18 A G 11: 93,885,380 V93A probably benign Het
Utrn T C 10: 12,401,335 N3413D possibly damaging Het
Zhx1 T C 15: 58,053,251 D533G possibly damaging Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60235191 nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60281883 missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60328103 missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60217225 missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60181741 missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60195011 critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60195143 missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60235353 missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60281341 missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60230628 missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60217255 missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60242535 critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60272259 critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60253501 missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60329335 missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60235237 missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60283987 missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60287444 splice site probably benign
IGL02945:Nbeal1 APN 1 60206410 missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60253413 missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60278727 missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60236459 missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60234868 missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60234869 missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60261586 critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60242567 nonsense probably null
Committee UTSW 1 60292903 missense probably damaging 1.00
Disgrace UTSW 1 60281310 nonsense probably null
Dravrah UTSW 1 60284092 missense probably damaging 1.00
Harvard UTSW 1 60235563 unclassified probably null
Lampoon UTSW 1 60261586 critical splice donor site probably null
National UTSW 1 60222263 missense possibly damaging 0.95
phainopepla UTSW 1 60319687 missense probably damaging 1.00
silky UTSW 1 60330878 splice site probably benign
3-1:Nbeal1 UTSW 1 60264272 splice site probably benign
P0007:Nbeal1 UTSW 1 60319688 missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60291937 missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60281871 missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60310263 missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60228612 splice site probably benign
R0054:Nbeal1 UTSW 1 60287401 utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60305309 missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60305370 splice site probably benign
R0324:Nbeal1 UTSW 1 60292873 missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60247734 missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60268439 missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60281832 nonsense probably null
R1034:Nbeal1 UTSW 1 60290006 nonsense probably null
R1082:Nbeal1 UTSW 1 60312226 missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60260269 missense probably benign
R1187:Nbeal1 UTSW 1 60194528 missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60200939 missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60305291 missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60200119 missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60260334 missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60284092 missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60267941 nonsense probably null
R1952:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60206344 missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60319687 missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60292964 splice site probably null
R2055:Nbeal1 UTSW 1 60311057 missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60270356 missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60305271 splice site probably null
R2181:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60281895 missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60284006 missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60330878 splice site probably benign
R2268:Nbeal1 UTSW 1 60330878 splice site probably benign
R2351:Nbeal1 UTSW 1 60237098 missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60251352 missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60251370 missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60251413 splice site probably benign
R3747:Nbeal1 UTSW 1 60195023 missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60194599 splice site probably benign
R4119:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60330948 missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60289946 missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60267774 missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60281310 nonsense probably null
R4618:Nbeal1 UTSW 1 60228731 intron probably benign
R4673:Nbeal1 UTSW 1 60329390 missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60235563 unclassified probably null
R4798:Nbeal1 UTSW 1 60222193 unclassified probably null
R4826:Nbeal1 UTSW 1 60251342 missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60292903 missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60238654 missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60237179 missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60270328 missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60235559 nonsense probably null
R5345:Nbeal1 UTSW 1 60328210 critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60310999 missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60277194 missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60237152 missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60242602 missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60291847 missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60272221 missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60228791 intron probably benign
R5918:Nbeal1 UTSW 1 60267892 missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60248395 missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60248405 missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60181556 start gained probably benign
R6113:Nbeal1 UTSW 1 60222263 missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60251307 missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60257484 missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60222128 missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60295924 missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60248365 missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60238719 missense probably benign
R6457:Nbeal1 UTSW 1 60253474 missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60330942 missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60281310 nonsense probably null
R7021:Nbeal1 UTSW 1 60261586 critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60310947 missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60237158 missense probably damaging 1.00
R7157:Nbeal1 UTSW 1 60260634 nonsense probably null
R7209:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7212:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7312:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
X0022:Nbeal1 UTSW 1 60277232 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATGACTCTTAAGGACTCAAAGG -3'
(R):5'- TCAGTTTAAACACTATGGGCAAACC -3'

Sequencing Primer
(F):5'- CTCAAAGGGAAAGTTACGCTTATG -3'
(R):5'- AAACCAGTGGCGCATGC -3'
Posted On2019-06-26