Incidental Mutation 'R7211:Pcna'
ID561041
Institutional Source Beutler Lab
Gene Symbol Pcna
Ensembl Gene ENSMUSG00000027342
Gene Nameproliferating cell nuclear antigen
Synonyms
Accession Numbers

Genbank: NM_011045.2

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7211 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location132249162-132253314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 132249872 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 203 (V203G)
Ref Sequence ENSEMBL: ENSMUSP00000028817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028816] [ENSMUST00000028817] [ENSMUST00000110163] [ENSMUST00000110164] [ENSMUST00000180286]
Predicted Effect probably benign
Transcript: ENSMUST00000028816
SMART Domains Protein: ENSMUSP00000028816
Gene: ENSMUSG00000027341

DomainStartEndE-ValueType
Pfam:DUF872 14 118 5.5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000028817
AA Change: V203G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028817
Gene: ENSMUSG00000027342
AA Change: V203G

DomainStartEndE-ValueType
Pfam:PCNA_N 1 125 1.4e-61 PFAM
Pfam:Rad1 1 236 2e-10 PFAM
Pfam:Rad9 12 245 1.3e-9 PFAM
Pfam:PCNA_C 127 254 8.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110163
SMART Domains Protein: ENSMUSP00000105792
Gene: ENSMUSG00000027341

DomainStartEndE-ValueType
Pfam:DUF872 14 118 5.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110164
SMART Domains Protein: ENSMUSP00000105793
Gene: ENSMUSG00000027341

DomainStartEndE-ValueType
Pfam:DUF872 14 118 5.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180286
SMART Domains Protein: ENSMUSP00000136826
Gene: ENSMUSG00000027341

DomainStartEndE-ValueType
Pfam:DUF872 3 118 1.7e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus and is a cofactor of DNA polymerase delta. The encoded protein acts as a homotrimer and helps increase the processivity of leading strand synthesis during DNA replication. In response to DNA damage, this protein is ubiquitinated and is involved in the RAD6-dependent DNA repair pathway. Two transcript variants encoding the same protein have been found for this gene. Pseudogenes of this gene have been described on chromosome 4 and on the X chromosome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation due to defects in DNA replication. Mice homozygous for a knock-in allele show partial embryonic lethality during organogenesis, absent germ cells, infertility, and altered somatic hypermutation frequency. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(4) Gene trapped(2)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G T 9: 51,290,433 Q108K probably damaging Het
9930021J03Rik A G 19: 29,786,312 F121S Het
a T A 2: 155,045,779 V53E probably damaging Het
A1cf A G 19: 31,927,141 Y268C probably benign Het
Adamts13 C T 2: 26,989,298 T621I probably benign Het
AI464131 A G 4: 41,498,028 I534T probably damaging Het
Akr1b7 A T 6: 34,421,114 N293Y probably benign Het
Angpt2 T A 8: 18,741,131 T50S probably benign Het
Anks1b C A 10: 90,511,070 A744D possibly damaging Het
Aqr A G 2: 114,134,723 V587A probably benign Het
Atm A G 9: 53,488,560 V1540A probably benign Het
BC022687 T A 12: 112,811,012 probably null Het
C4b A G 17: 34,735,534 V887A possibly damaging Het
Cd200r1 A G 16: 44,788,757 T26A probably benign Het
Ciao1 A G 2: 127,247,008 probably null Het
Clca3a2 A G 3: 144,814,014 C200R probably benign Het
Col6a5 T A 9: 105,928,164 Q1181L unknown Het
Copb2 T A 9: 98,574,145 I244N probably damaging Het
Cpb2 A G 14: 75,274,990 Y281C probably damaging Het
Disp3 C A 4: 148,241,522 V1260F probably damaging Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
Dpysl2 T C 14: 66,829,976 N162S probably damaging Het
Dsp T A 13: 38,188,535 probably null Het
Epm2a T C 10: 11,343,675 Y69H probably benign Het
Frzb C A 2: 80,418,325 E262* probably null Het
Gaa T C 11: 119,284,204 V877A possibly damaging Het
Gm11639 C A 11: 104,710,713 A284D probably benign Het
Gm11639 G T 11: 104,724,609 probably null Het
Gm5346 T A 8: 43,625,877 S437C probably damaging Het
Gpnmb T C 6: 49,052,015 I489T possibly damaging Het
Gpr31b T C 17: 13,052,217 T22A probably benign Het
Gys1 T A 7: 45,448,260 F477Y possibly damaging Het
Hoxc11 A C 15: 102,955,052 E176A possibly damaging Het
Kcnk13 T A 12: 100,061,817 F384I probably damaging Het
Ky A G 9: 102,509,150 E59G probably benign Het
Lama4 T A 10: 39,005,495 D93E probably damaging Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Lrrc71 G T 3: 87,743,326 Q210K possibly damaging Het
Map1a G A 2: 121,304,643 R1980H probably benign Het
Med15 T C 16: 17,698,113 D15G unknown Het
Mfng A T 15: 78,773,068 S69T probably benign Het
Muc16 T G 9: 18,498,570 S181R probably damaging Het
Mug1 A T 6: 121,880,539 Q1074L possibly damaging Het
Nbea T A 3: 56,004,901 N1155I probably benign Het
Nbeal1 T G 1: 60,200,951 L159V probably damaging Het
Nudt1 C A 5: 140,337,647 P118Q possibly damaging Het
Olfr450 A T 6: 42,818,016 T182S probably benign Het
Olfr970 A C 9: 39,819,858 Q73P possibly damaging Het
Pcdhga6 T A 18: 37,709,120 V631D probably benign Het
Pgf G T 12: 85,175,775 N33K probably benign Het
Pgm1 T C 5: 64,105,850 L280P probably damaging Het
Plcg1 G A 2: 160,731,874 A20T probably benign Het
Prdx5 G T 19: 6,907,590 D126E probably damaging Het
Prkag2 T C 5: 24,995,298 T20A probably benign Het
Prr14l T A 5: 32,830,087 Q688L probably damaging Het
Pxdn T G 12: 29,984,904 D253E possibly damaging Het
Rbm18 A T 2: 36,122,893 C53* probably null Het
Rprm A T 2: 54,085,258 L16Q probably benign Het
Saysd1 A G 14: 20,077,508 F116S probably damaging Het
Scg3 A G 9: 75,682,084 S96P probably benign Het
Scgb1b3 C T 7: 31,375,653 L16F unknown Het
Sh3tc2 A G 18: 61,989,403 T412A probably benign Het
Skint6 T C 4: 113,238,369 N31S probably benign Het
Slc22a2 T C 17: 12,586,883 probably null Het
Slc8a2 C T 7: 16,140,613 T262I possibly damaging Het
Smarcc1 A T 9: 110,150,014 K188N probably damaging Het
Srrm1 CGAGGAGGAGGAGG CGAGGAGGAGG 4: 135,327,128 probably benign Het
Taf6 T C 5: 138,178,826 T660A possibly damaging Het
Tbx2 C T 11: 85,834,714 R164C probably damaging Het
Tec T C 5: 72,782,012 D220G probably null Het
Tfec A T 6: 16,867,465 W59R probably damaging Het
Tmtc2 G T 10: 105,573,726 S8R probably benign Het
Tmtc3 A T 10: 100,447,605 M696K probably benign Het
Trpc3 A T 3: 36,640,733 S691T possibly damaging Het
Ttf2 A T 3: 100,959,307 M503K probably benign Het
Ttll7 A G 3: 146,913,276 H312R probably damaging Het
Ttn T C 2: 76,767,688 Y19627C probably damaging Het
Ugt2b35 T C 5: 87,001,318 S143P probably benign Het
Usp53 A G 3: 122,957,650 S253P probably damaging Het
Utp18 A G 11: 93,885,380 V93A probably benign Het
Utrn T C 10: 12,401,335 N3413D possibly damaging Het
Zhx1 T C 15: 58,053,251 D533G possibly damaging Het
Other mutations in Pcna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Pcna APN 2 132251932 missense probably benign 0.12
IGL00839:Pcna APN 2 132251420 missense probably benign 0.00
IGL01463:Pcna APN 2 132251429 missense probably damaging 1.00
IGL02437:Pcna APN 2 132251235 unclassified probably benign
IGL03083:Pcna APN 2 132251753 missense probably benign 0.10
IGL03084:Pcna APN 2 132251753 missense probably benign 0.10
IGL03094:Pcna APN 2 132251753 missense probably benign 0.10
IGL03124:Pcna APN 2 132251753 missense probably benign 0.10
IGL03046:Pcna UTSW 2 132251753 missense probably benign 0.10
NA:Pcna UTSW 2 132249884 missense probably benign 0.01
R0722:Pcna UTSW 2 132251235 unclassified probably benign
R1928:Pcna UTSW 2 132251897 unclassified probably benign
R3857:Pcna UTSW 2 132249621 missense probably benign 0.00
R7296:Pcna UTSW 2 132252877 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCATCTTCAATCTTGGGAGCC -3'
(R):5'- TCTACAGGATGGGCAAGCTAGAC -3'

Sequencing Primer
(F):5'- ATACTTTAAGTGTCCCATGTCAGC -3'
(R):5'- GGTTTTCATCAACCCTTCCA -3'
Posted On2019-06-26