Incidental Mutation 'R7211:Pcdhga6'
ID561110
Institutional Source Beutler Lab
Gene Symbol Pcdhga6
Ensembl Gene ENSMUSG00000103793
Gene Nameprotocadherin gamma subfamily A, 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7211 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37707039-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37709120 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 631 (V631D)
Ref Sequence ENSEMBL: ENSMUSP00000141803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112] [ENSMUST00000195823]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
AA Change: V631D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793
AA Change: V631D

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G T 9: 51,290,433 Q108K probably damaging Het
9930021J03Rik A G 19: 29,786,312 F121S Het
a T A 2: 155,045,779 V53E probably damaging Het
A1cf A G 19: 31,927,141 Y268C probably benign Het
Adamts13 C T 2: 26,989,298 T621I probably benign Het
AI464131 A G 4: 41,498,028 I534T probably damaging Het
Akr1b7 A T 6: 34,421,114 N293Y probably benign Het
Angpt2 T A 8: 18,741,131 T50S probably benign Het
Anks1b C A 10: 90,511,070 A744D possibly damaging Het
Aqr A G 2: 114,134,723 V587A probably benign Het
Atm A G 9: 53,488,560 V1540A probably benign Het
BC022687 T A 12: 112,811,012 probably null Het
C4b A G 17: 34,735,534 V887A possibly damaging Het
Cd200r1 A G 16: 44,788,757 T26A probably benign Het
Ciao1 A G 2: 127,247,008 probably null Het
Clca3a2 A G 3: 144,814,014 C200R probably benign Het
Col6a5 T A 9: 105,928,164 Q1181L unknown Het
Copb2 T A 9: 98,574,145 I244N probably damaging Het
Cpb2 A G 14: 75,274,990 Y281C probably damaging Het
Disp3 C A 4: 148,241,522 V1260F probably damaging Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
Dpysl2 T C 14: 66,829,976 N162S probably damaging Het
Dsp T A 13: 38,188,535 probably null Het
Edc4 T A 8: 105,886,309 probably null Het
Epm2a T C 10: 11,343,675 Y69H probably benign Het
Frzb C A 2: 80,418,325 E262* probably null Het
Gaa T C 11: 119,284,204 V877A possibly damaging Het
Gm11639 C A 11: 104,710,713 A284D probably benign Het
Gm11639 G T 11: 104,724,609 probably null Het
Gm5346 T A 8: 43,625,877 S437C probably damaging Het
Gpnmb T C 6: 49,052,015 I489T possibly damaging Het
Gpr31b T C 17: 13,052,217 T22A probably benign Het
Gys1 T A 7: 45,448,260 F477Y possibly damaging Het
Hoxc11 A C 15: 102,955,052 E176A possibly damaging Het
Kcnk13 T A 12: 100,061,817 F384I probably damaging Het
Ky A G 9: 102,509,150 E59G probably benign Het
Lama4 T A 10: 39,005,495 D93E probably damaging Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Lrrc71 G T 3: 87,743,326 Q210K possibly damaging Het
Map1a G A 2: 121,304,643 R1980H probably benign Het
Med15 T C 16: 17,698,113 D15G unknown Het
Mfng A T 15: 78,773,068 S69T probably benign Het
Muc16 T G 9: 18,498,570 S181R probably damaging Het
Mug1 A T 6: 121,880,539 Q1074L possibly damaging Het
Nbea T A 3: 56,004,901 N1155I probably benign Het
Nbeal1 T G 1: 60,200,951 L159V probably damaging Het
Nudt1 C A 5: 140,337,647 P118Q possibly damaging Het
Olfr450 A T 6: 42,818,016 T182S probably benign Het
Olfr970 A C 9: 39,819,858 Q73P possibly damaging Het
Pcna A C 2: 132,249,872 V203G probably damaging Het
Pgf G T 12: 85,175,775 N33K probably benign Het
Pgm1 T C 5: 64,105,850 L280P probably damaging Het
Plcg1 G A 2: 160,731,874 A20T probably benign Het
Prdx5 G T 19: 6,907,590 D126E probably damaging Het
Prkag2 T C 5: 24,995,298 T20A probably benign Het
Prr14l T A 5: 32,830,087 Q688L probably damaging Het
Pxdn T G 12: 29,984,904 D253E possibly damaging Het
Rbm18 A T 2: 36,122,893 C53* probably null Het
Rprm A T 2: 54,085,258 L16Q probably benign Het
Saysd1 A G 14: 20,077,508 F116S probably damaging Het
Scg3 A G 9: 75,682,084 S96P probably benign Het
Scgb1b3 C T 7: 31,375,653 L16F unknown Het
Sh3tc2 A G 18: 61,989,403 T412A probably benign Het
Skint6 T C 4: 113,238,369 N31S probably benign Het
Slc22a2 T C 17: 12,586,883 probably null Het
Slc8a2 C T 7: 16,140,613 T262I possibly damaging Het
Smarcc1 A T 9: 110,150,014 K188N probably damaging Het
Taf6 T C 5: 138,178,826 T660A possibly damaging Het
Tbx2 C T 11: 85,834,714 R164C probably damaging Het
Tec T C 5: 72,782,012 D220G probably null Het
Tfec A T 6: 16,867,465 W59R probably damaging Het
Tmtc2 G T 10: 105,573,726 S8R probably benign Het
Tmtc3 A T 10: 100,447,605 M696K probably benign Het
Trpc3 A T 3: 36,640,733 S691T possibly damaging Het
Ttf2 A T 3: 100,959,307 M503K probably benign Het
Ttll7 A G 3: 146,913,276 H312R probably damaging Het
Ttn T C 2: 76,767,688 Y19627C probably damaging Het
Ugt2b35 T C 5: 87,001,318 S143P probably benign Het
Usp53 A G 3: 122,957,650 S253P probably damaging Het
Utp18 A G 11: 93,885,380 V93A probably benign Het
Utrn T C 10: 12,401,335 N3413D possibly damaging Het
Zhx1 T C 15: 58,053,251 D533G possibly damaging Het
Other mutations in Pcdhga6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3551:Pcdhga6 UTSW 18 37708217 missense probably benign 0.42
R3552:Pcdhga6 UTSW 18 37708217 missense probably benign 0.42
R3688:Pcdhga6 UTSW 18 37708541 missense probably damaging 1.00
R3713:Pcdhga6 UTSW 18 37707923 missense probably damaging 0.99
R3832:Pcdhga6 UTSW 18 37708426 missense probably damaging 1.00
R3833:Pcdhga6 UTSW 18 37708426 missense probably damaging 1.00
R4607:Pcdhga6 UTSW 18 37708618 missense probably damaging 1.00
R5594:Pcdhga6 UTSW 18 37708528 missense probably benign 0.40
R5608:Pcdhga6 UTSW 18 37707461 missense possibly damaging 0.50
R5887:Pcdhga6 UTSW 18 37708559 missense probably damaging 1.00
R6188:Pcdhga6 UTSW 18 37708271 missense probably benign 0.00
R6276:Pcdhga6 UTSW 18 37707644 missense probably benign 0.28
R6494:Pcdhga6 UTSW 18 37708541 missense probably damaging 1.00
R6619:Pcdhga6 UTSW 18 37709649 missense probably benign 0.00
R7145:Pcdhga6 UTSW 18 37707728 missense probably damaging 0.99
R7313:Pcdhga6 UTSW 18 37708019 missense possibly damaging 0.60
R7425:Pcdhga6 UTSW 18 37708566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGGATGGTTCTACTGGTG -3'
(R):5'- ATGCACGAAACAGTGGCCAC -3'

Sequencing Primer
(F):5'- CTACTGGTGTGGAGCTGGCC -3'
(R):5'- CCACCAGGTAGATTGTAAGGCTTG -3'
Posted On2019-06-26