Incidental Mutation 'R7213:2010315B03Rik'
ID561223
Institutional Source Beutler Lab
Gene Symbol 2010315B03Rik
Ensembl Gene ENSMUSG00000074829
Gene NameRIKEN cDNA 2010315B03 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7213 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location124291804-124312696 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 124293900 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 131 (Y131*)
Ref Sequence ENSEMBL: ENSMUSP00000137258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071300] [ENSMUST00000177714] [ENSMUST00000185949] [ENSMUST00000189915]
Predicted Effect probably null
Transcript: ENSMUST00000071300
AA Change: Y152*
SMART Domains Protein: ENSMUSP00000071269
Gene: ENSMUSG00000074829
AA Change: Y152*

DomainStartEndE-ValueType
KRAB 24 86 5.28e-14 SMART
ZnF_C2H2 95 117 5.9e-3 SMART
ZnF_C2H2 123 145 1.26e-2 SMART
ZnF_C2H2 151 173 2.95e-3 SMART
ZnF_C2H2 179 201 4.24e-4 SMART
ZnF_C2H2 207 229 1.38e-3 SMART
ZnF_C2H2 235 257 3.21e-4 SMART
ZnF_C2H2 263 285 1.26e-2 SMART
ZnF_C2H2 291 312 6.08e0 SMART
ZnF_C2H2 318 340 8.6e-5 SMART
ZnF_C2H2 346 368 1.36e-2 SMART
ZnF_C2H2 374 396 8.02e-5 SMART
ZnF_C2H2 402 424 9.58e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177714
AA Change: Y131*
SMART Domains Protein: ENSMUSP00000137258
Gene: ENSMUSG00000074829
AA Change: Y131*

DomainStartEndE-ValueType
KRAB 28 90 5.28e-14 SMART
ZnF_C2H2 99 121 5.9e-3 SMART
ZnF_C2H2 127 149 1.26e-2 SMART
ZnF_C2H2 155 177 2.95e-3 SMART
ZnF_C2H2 183 205 4.24e-4 SMART
ZnF_C2H2 211 233 1.38e-3 SMART
ZnF_C2H2 239 261 3.21e-4 SMART
ZnF_C2H2 267 289 1.26e-2 SMART
ZnF_C2H2 295 316 6.08e0 SMART
ZnF_C2H2 322 344 8.6e-5 SMART
ZnF_C2H2 350 372 1.36e-2 SMART
ZnF_C2H2 378 400 8.02e-5 SMART
ZnF_C2H2 406 428 9.58e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185949
AA Change: Y156*
SMART Domains Protein: ENSMUSP00000140144
Gene: ENSMUSG00000074829
AA Change: Y156*

DomainStartEndE-ValueType
KRAB 29 91 2.3e-16 SMART
ZnF_C2H2 100 122 2.5e-5 SMART
ZnF_C2H2 128 150 5.3e-5 SMART
ZnF_C2H2 156 175 5.1e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189915
AA Change: Y128*
SMART Domains Protein: ENSMUSP00000140738
Gene: ENSMUSG00000074829
AA Change: Y128*

DomainStartEndE-ValueType
KRAB 1 63 2.3e-16 SMART
ZnF_C2H2 72 94 2.5e-5 SMART
ZnF_C2H2 100 122 5.3e-5 SMART
ZnF_C2H2 128 150 1.2e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,853,629 V94D probably damaging Het
Actr1b T A 1: 36,702,140 N120I probably damaging Het
Adam17 A T 12: 21,336,678 Y452* probably null Het
Adam19 A T 11: 46,121,471 T265S probably benign Het
Adgrb1 A G 15: 74,569,884 T945A probably benign Het
BC067074 T A 13: 113,317,941 F174I Het
Bpifa5 G A 2: 154,165,983 V182M possibly damaging Het
Celsr3 C T 9: 108,849,040 T3156I probably damaging Het
Cntrl A G 2: 35,135,680 M674V possibly damaging Het
Cry2 C T 2: 92,413,659 V390I probably benign Het
Cwc25 G T 11: 97,754,029 Q168K probably benign Het
Dcbld2 C T 16: 58,450,763 A301V probably benign Het
Dclre1a T C 19: 56,529,635 Y1004C probably damaging Het
Ddhd1 A C 14: 45,657,753 S87A probably benign Het
Ear1 A G 14: 43,819,154 C86R probably damaging Het
Fat2 A T 11: 55,281,045 Y2947* probably null Het
Fat4 G A 3: 38,999,087 V4077M possibly damaging Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fto A T 8: 91,391,507 Q29L probably benign Het
Gk5 C T 9: 96,145,712 T200M probably damaging Het
Gm5916 C T 9: 36,128,650 G14E possibly damaging Het
Gm9972 A T 11: 43,036,408 probably benign Het
Gpr139 T A 7: 119,145,099 M88L probably benign Het
Gpr26 T C 7: 131,967,490 L188P probably damaging Het
Hbp1 A T 12: 31,937,197 S219T probably benign Het
Hist1h2ab G T 13: 23,751,163 A11S unknown Het
Hr A T 14: 70,558,350 E445V probably damaging Het
Il12rb1 A G 8: 70,816,453 K426E probably benign Het
Itgbl1 G A 14: 123,973,297 C469Y probably damaging Het
Kdm2b A T 5: 122,921,469 N523K probably damaging Het
Kptn A G 7: 16,120,779 N125S possibly damaging Het
Krt17 T C 11: 100,258,530 N238S probably benign Het
Lemd3 G A 10: 120,978,240 R363* probably null Het
Mmrn1 G A 6: 60,944,543 probably benign Het
Mtus1 T C 8: 41,084,487 D64G probably damaging Het
Muc16 A G 9: 18,641,416 V4527A probably benign Het
Naip2 T A 13: 100,187,483 D193V probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nf1 A G 11: 79,469,819 H1462R probably benign Het
Olfr133 T C 17: 38,149,074 V162A probably benign Het
Olfr988 A T 2: 85,353,556 Y123* probably null Het
Pappa2 T A 1: 158,936,886 T352S possibly damaging Het
Pcnt A G 10: 76,408,904 L1114P probably damaging Het
Pde6b T C 5: 108,404,090 Y212H probably damaging Het
Pik3c2g A T 6: 139,860,264 I604F Het
Pld2 A G 11: 70,553,372 D498G probably benign Het
Prag1 A T 8: 36,146,615 Q1107L probably damaging Het
Pwp1 A T 10: 85,876,309 I110F probably benign Het
Rims4 C T 2: 163,864,061 V218I probably benign Het
Rnf10 C T 5: 115,242,473 S754N probably damaging Het
Rnf10 T C 5: 115,242,474 S754G probably damaging Het
Sel1l2 A T 2: 140,244,135 V512E probably damaging Het
Shank2 T A 7: 144,031,409 M49K probably benign Het
Sipa1 T C 19: 5,660,523 D153G probably damaging Het
Slc46a2 C T 4: 59,914,279 V215I possibly damaging Het
Slco6c1 G A 1: 97,127,946 L77F probably benign Het
Smarca2 T C 19: 26,647,131 L397P possibly damaging Het
Spg7 C T 8: 123,090,232 A554V probably damaging Het
Stab1 T A 14: 31,143,673 M1753L probably benign Het
Stk11 A G 10: 80,116,618 M1V probably null Het
Supt6 C A 11: 78,232,150 G136C probably damaging Het
Svil G T 18: 5,094,574 R1418L probably damaging Het
Tfg A G 16: 56,701,153 S167P probably benign Het
Timeless T C 10: 128,243,289 V335A probably benign Het
Tll2 C A 19: 41,120,227 R328L probably damaging Het
Tomm7 T C 5: 23,844,061 S5G possibly damaging Het
Ttc39c G A 18: 12,687,081 probably null Het
Ttn T C 2: 76,725,761 E30300G probably benign Het
Tuba4a A T 1: 75,215,697 D452E possibly damaging Het
Tubgcp2 T C 7: 140,008,014 I233V probably benign Het
Tubgcp5 T A 7: 55,806,112 V296E probably damaging Het
Vmn2r53 T C 7: 12,601,056 S226G probably benign Het
Xrcc6 T C 15: 82,016,826 probably benign Het
Zfhx4 C A 3: 5,396,644 D1192E probably benign Het
Zfp180 G T 7: 24,104,513 W119L possibly damaging Het
Zfp3 A G 11: 70,772,525 I437V probably benign Het
Zfp616 A T 11: 74,085,863 Q986L probably benign Het
Zfp937 T A 2: 150,239,465 C472S probably damaging Het
Other mutations in 2010315B03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:2010315B03Rik APN 9 124295490 splice site probably benign
P4748:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0090:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0122:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0140:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0388:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0775:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0798:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R1467:2010315B03Rik UTSW 9 124295463 missense possibly damaging 0.91
R1569:2010315B03Rik UTSW 9 124293797 nonsense probably null
R2566:2010315B03Rik UTSW 9 124293071 missense probably damaging 0.97
R2566:2010315B03Rik UTSW 9 124293153 missense probably damaging 0.99
R3853:2010315B03Rik UTSW 9 124293346 missense probably damaging 1.00
R4092:2010315B03Rik UTSW 9 124293273 missense probably benign 0.03
R4109:2010315B03Rik UTSW 9 124295103 missense probably benign 0.01
R4646:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4648:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4705:2010315B03Rik UTSW 9 124294001 missense possibly damaging 0.86
R4764:2010315B03Rik UTSW 9 124293766 missense probably benign 0.01
R5110:2010315B03Rik UTSW 9 124295357 critical splice donor site probably null
R5117:2010315B03Rik UTSW 9 124293085 missense probably benign 0.00
R5162:2010315B03Rik UTSW 9 124293671 missense probably benign 0.08
R5226:2010315B03Rik UTSW 9 124294076 missense possibly damaging 0.91
R5426:2010315B03Rik UTSW 9 124294003 missense probably damaging 1.00
R6793:2010315B03Rik UTSW 9 124295422 missense possibly damaging 0.85
R6975:2010315B03Rik UTSW 9 124294057 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGACTGTGACGTGAATAGGCTT -3'
(R):5'- GTATTGTCAAAGATGCCTAAGAACTCA -3'

Sequencing Primer
(F):5'- CTGTGACGTGAATAGGCTTTACCAC -3'
(R):5'- GTAAAGCTTTCACGTGTGCC -3'
Posted On2019-06-26