Incidental Mutation 'R7213:Stk11'
ID561225
Institutional Source Beutler Lab
Gene Symbol Stk11
Ensembl Gene ENSMUSG00000003068
Gene Nameserine/threonine kinase 11
SynonymsPar-4, Lkb1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7213 (G1)
Quality Score205.009
Status Not validated
Chromosome10
Chromosomal Location80115803-80130682 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 80116618 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000003152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003152] [ENSMUST00000105371] [ENSMUST00000144883] [ENSMUST00000213772]
Predicted Effect probably null
Transcript: ENSMUST00000003152
AA Change: M1V

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000003152
Gene: ENSMUSG00000003068
AA Change: M1V

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105371
AA Change: M1V
Predicted Effect probably null
Transcript: ENSMUST00000144883
AA Change: M1V

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114195
Gene: ENSMUSG00000003068
AA Change: M1V

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
low complexity region 396 411 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000213772
AA Change: M1V

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the serine/threonine kinase family. The encoded protein, a known tumor suppressor, activates (via phosphorylation) adenine monophosphate-activated protein kinase (AMPK) and AMPK-related kinase proteins. This upstream regulation of the AMPK pathway is thought to regulate a number of different processes, including cell metabolism, cell polarity, apoptosis and DNA damage response. Mutations in a similar gene in human have been associated with Peutz-Jeghers syndrome. Alternative splicing results in multiple transcript variants, including the S isoform which plays a potential role in spermiogenesis. [provided by RefSeq, Sep 2014]
PHENOTYPE: Targeted heterozygous mutants with one inactivated allele develop benign gastrointestinal polyps. Homozygous null mutant are embryonic lethal. Homozygotes for a hypomorphic allele survive and apparently normal, but male mice are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G T 9: 124,293,900 Y131* probably null Het
2310009B15Rik A T 1: 138,853,629 V94D probably damaging Het
Actr1b T A 1: 36,702,140 N120I probably damaging Het
Adam17 A T 12: 21,336,678 Y452* probably null Het
Adam19 A T 11: 46,121,471 T265S probably benign Het
Adgrb1 A G 15: 74,569,884 T945A probably benign Het
BC067074 T A 13: 113,317,941 F174I Het
Bpifa5 G A 2: 154,165,983 V182M possibly damaging Het
Celsr3 C T 9: 108,849,040 T3156I probably damaging Het
Cntrl A G 2: 35,135,680 M674V possibly damaging Het
Cry2 C T 2: 92,413,659 V390I probably benign Het
Cwc25 G T 11: 97,754,029 Q168K probably benign Het
Dcbld2 C T 16: 58,450,763 A301V probably benign Het
Dclre1a T C 19: 56,529,635 Y1004C probably damaging Het
Ddhd1 A C 14: 45,657,753 S87A probably benign Het
Ear1 A G 14: 43,819,154 C86R probably damaging Het
Fat2 A T 11: 55,281,045 Y2947* probably null Het
Fat4 G A 3: 38,999,087 V4077M possibly damaging Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fto A T 8: 91,391,507 Q29L probably benign Het
Gk5 C T 9: 96,145,712 T200M probably damaging Het
Gm5916 C T 9: 36,128,650 G14E possibly damaging Het
Gm9972 A T 11: 43,036,408 probably benign Het
Gpr139 T A 7: 119,145,099 M88L probably benign Het
Gpr26 T C 7: 131,967,490 L188P probably damaging Het
Hbp1 A T 12: 31,937,197 S219T probably benign Het
Hist1h2ab G T 13: 23,751,163 A11S unknown Het
Hr A T 14: 70,558,350 E445V probably damaging Het
Il12rb1 A G 8: 70,816,453 K426E probably benign Het
Itgbl1 G A 14: 123,973,297 C469Y probably damaging Het
Kdm2b A T 5: 122,921,469 N523K probably damaging Het
Kptn A G 7: 16,120,779 N125S possibly damaging Het
Krt17 T C 11: 100,258,530 N238S probably benign Het
Lemd3 G A 10: 120,978,240 R363* probably null Het
Mmrn1 G A 6: 60,944,543 probably benign Het
Mtus1 T C 8: 41,084,487 D64G probably damaging Het
Muc16 A G 9: 18,641,416 V4527A probably benign Het
Naip2 T A 13: 100,187,483 D193V probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nf1 A G 11: 79,469,819 H1462R probably benign Het
Olfr133 T C 17: 38,149,074 V162A probably benign Het
Olfr988 A T 2: 85,353,556 Y123* probably null Het
Pappa2 T A 1: 158,936,886 T352S possibly damaging Het
Pcnt A G 10: 76,408,904 L1114P probably damaging Het
Pde6b T C 5: 108,404,090 Y212H probably damaging Het
Pik3c2g A T 6: 139,860,264 I604F Het
Pld2 A G 11: 70,553,372 D498G probably benign Het
Prag1 A T 8: 36,146,615 Q1107L probably damaging Het
Pwp1 A T 10: 85,876,309 I110F probably benign Het
Rims4 C T 2: 163,864,061 V218I probably benign Het
Rnf10 C T 5: 115,242,473 S754N probably damaging Het
Rnf10 T C 5: 115,242,474 S754G probably damaging Het
Sel1l2 A T 2: 140,244,135 V512E probably damaging Het
Shank2 T A 7: 144,031,409 M49K probably benign Het
Sipa1 T C 19: 5,660,523 D153G probably damaging Het
Slc46a2 C T 4: 59,914,279 V215I possibly damaging Het
Slco6c1 G A 1: 97,127,946 L77F probably benign Het
Smarca2 T C 19: 26,647,131 L397P possibly damaging Het
Spg7 C T 8: 123,090,232 A554V probably damaging Het
Stab1 T A 14: 31,143,673 M1753L probably benign Het
Supt6 C A 11: 78,232,150 G136C probably damaging Het
Svil G T 18: 5,094,574 R1418L probably damaging Het
Tfg A G 16: 56,701,153 S167P probably benign Het
Timeless T C 10: 128,243,289 V335A probably benign Het
Tll2 C A 19: 41,120,227 R328L probably damaging Het
Tomm7 T C 5: 23,844,061 S5G possibly damaging Het
Ttc39c G A 18: 12,687,081 probably null Het
Ttn T C 2: 76,725,761 E30300G probably benign Het
Tuba4a A T 1: 75,215,697 D452E possibly damaging Het
Tubgcp2 T C 7: 140,008,014 I233V probably benign Het
Tubgcp5 T A 7: 55,806,112 V296E probably damaging Het
Vmn2r53 T C 7: 12,601,056 S226G probably benign Het
Xrcc6 T C 15: 82,016,826 probably benign Het
Zfhx4 C A 3: 5,396,644 D1192E probably benign Het
Zfp180 G T 7: 24,104,513 W119L possibly damaging Het
Zfp3 A G 11: 70,772,525 I437V probably benign Het
Zfp616 A T 11: 74,085,863 Q986L probably benign Het
Zfp937 T A 2: 150,239,465 C472S probably damaging Het
Other mutations in Stk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02695:Stk11 APN 10 80125477 critical splice acceptor site probably null
IGL03055:Stk11 UTSW 10 80128086 missense probably damaging 1.00
R0450:Stk11 UTSW 10 80126086 missense probably damaging 1.00
R0469:Stk11 UTSW 10 80126086 missense probably damaging 1.00
R0501:Stk11 UTSW 10 80126285 missense probably damaging 1.00
R3826:Stk11 UTSW 10 80127948 unclassified probably null
R3827:Stk11 UTSW 10 80127948 unclassified probably null
R3828:Stk11 UTSW 10 80127948 unclassified probably null
R3829:Stk11 UTSW 10 80127948 unclassified probably null
R4512:Stk11 UTSW 10 80126377 splice site probably benign
R4515:Stk11 UTSW 10 80116601 unclassified probably benign
R5123:Stk11 UTSW 10 80127941 missense probably damaging 1.00
R5188:Stk11 UTSW 10 80126279 missense probably damaging 1.00
R5341:Stk11 UTSW 10 80126260 missense probably benign 0.13
R5540:Stk11 UTSW 10 80126049 missense probably benign 0.00
R6856:Stk11 UTSW 10 80128090 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGTGAAGAATTGGCGCCC -3'
(R):5'- ATAAGGTCTCGGAGTCCAGCAC -3'

Sequencing Primer
(F):5'- AATTGGCGCCCAGGAAGC -3'
(R):5'- TCACCTTGCCGTACGAGC -3'
Posted On2019-06-26