Incidental Mutation 'R7213:Xrcc6'
ID561250
Institutional Source Beutler Lab
Gene Symbol Xrcc6
Ensembl Gene ENSMUSG00000022471
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 6
SynonymsKu p70, G22p1, Ku70
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7213 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location81987835-82040085 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 82016826 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023110] [ENSMUST00000069530] [ENSMUST00000089187] [ENSMUST00000100399] [ENSMUST00000135988] [ENSMUST00000146628] [ENSMUST00000152227] [ENSMUST00000164779] [ENSMUST00000165777] [ENSMUST00000168581]
Predicted Effect probably benign
Transcript: ENSMUST00000023110
SMART Domains Protein: ENSMUSP00000023110
Gene: ENSMUSG00000022472

DomainStartEndE-ValueType
PDB:2WP7|A 1 30 2e-14 PDB
Blast:DUF862 7 56 3e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000069530
SMART Domains Protein: ENSMUSP00000068559
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 467 557 5e-34 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089187
Predicted Effect probably benign
Transcript: ENSMUST00000100399
SMART Domains Protein: ENSMUSP00000097968
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 470 555 3.1e-31 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135988
SMART Domains Protein: ENSMUSP00000117613
Gene: ENSMUSG00000022472

DomainStartEndE-ValueType
DUF862 7 106 5.05e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146628
SMART Domains Protein: ENSMUSP00000114888
Gene: ENSMUSG00000022472

DomainStartEndE-ValueType
PDB:3EBQ|A 1 84 9e-22 PDB
Blast:DUF862 7 84 6e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152227
SMART Domains Protein: ENSMUSP00000121504
Gene: ENSMUSG00000022472

DomainStartEndE-ValueType
DUF862 7 150 1.68e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164779
SMART Domains Protein: ENSMUSP00000127927
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
Pfam:Ku_N 1 96 4.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165777
SMART Domains Protein: ENSMUSP00000131212
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Ku_N 35 106 7.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168581
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The p70/p80 autoantigen is a nuclear complex consisting of two subunits with molecular masses of approximately 70 and 80 kDa. The complex functions as a single-stranded DNA-dependent ATP-dependent helicase. The complex may be involved in the repair of nonhomologous DNA ends such as that required for double-strand break repair, transposition, and V(D)J recombination. High levels of autoantibodies to p70 and p80 have been found in some patients with systemic lupus erythematosus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuron apoptosis, decreased body size, abnormal B and T cell morphology, increased incidence of tumorigenesis, and increased cellular sensitivity to irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G T 9: 124,293,900 Y131* probably null Het
2310009B15Rik A T 1: 138,853,629 V94D probably damaging Het
Actr1b T A 1: 36,702,140 N120I probably damaging Het
Adam17 A T 12: 21,336,678 Y452* probably null Het
Adam19 A T 11: 46,121,471 T265S probably benign Het
Adgrb1 A G 15: 74,569,884 T945A probably benign Het
BC067074 T A 13: 113,317,941 F174I Het
Bpifa5 G A 2: 154,165,983 V182M possibly damaging Het
Celsr3 C T 9: 108,849,040 T3156I probably damaging Het
Cntrl A G 2: 35,135,680 M674V possibly damaging Het
Cry2 C T 2: 92,413,659 V390I probably benign Het
Cwc25 G T 11: 97,754,029 Q168K probably benign Het
Dcbld2 C T 16: 58,450,763 A301V probably benign Het
Dclre1a T C 19: 56,529,635 Y1004C probably damaging Het
Ddhd1 A C 14: 45,657,753 S87A probably benign Het
Ear1 A G 14: 43,819,154 C86R probably damaging Het
Epha5 T C 5: 84,233,923 probably null Het
Fat2 A T 11: 55,281,045 Y2947* probably null Het
Fat4 G A 3: 38,999,087 V4077M possibly damaging Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fbxo16 A G 14: 65,299,419 probably null Het
Fto A T 8: 91,391,507 Q29L probably benign Het
Gk5 C T 9: 96,145,712 T200M probably damaging Het
Gm5916 C T 9: 36,128,650 G14E possibly damaging Het
Gm9972 A T 11: 43,036,408 probably benign Het
Gpr139 T A 7: 119,145,099 M88L probably benign Het
Gpr26 T C 7: 131,967,490 L188P probably damaging Het
Hbp1 A T 12: 31,937,197 S219T probably benign Het
Hist1h2ab G T 13: 23,751,163 A11S unknown Het
Hr A T 14: 70,558,350 E445V probably damaging Het
Il12rb1 A G 8: 70,816,453 K426E probably benign Het
Itgbl1 G A 14: 123,973,297 C469Y probably damaging Het
Kdm2b A T 5: 122,921,469 N523K probably damaging Het
Kptn A G 7: 16,120,779 N125S possibly damaging Het
Krt17 T C 11: 100,258,530 N238S probably benign Het
Lemd3 G A 10: 120,978,240 R363* probably null Het
Mmrn1 G A 6: 60,944,543 probably benign Het
Mtus1 T C 8: 41,084,487 D64G probably damaging Het
Muc16 A G 9: 18,641,416 V4527A probably benign Het
Naip2 T A 13: 100,187,483 D193V probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nf1 A G 11: 79,469,819 H1462R probably benign Het
Olfr133 T C 17: 38,149,074 V162A probably benign Het
Olfr988 A T 2: 85,353,556 Y123* probably null Het
Pappa2 T A 1: 158,936,886 T352S possibly damaging Het
Pcnt A G 10: 76,408,904 L1114P probably damaging Het
Pde6b T C 5: 108,404,090 Y212H probably damaging Het
Pik3c2g A T 6: 139,860,264 I604F Het
Pld2 A G 11: 70,553,372 D498G probably benign Het
Prag1 A T 8: 36,146,615 Q1107L probably damaging Het
Pwp1 A T 10: 85,876,309 I110F probably benign Het
Rims4 C T 2: 163,864,061 V218I probably benign Het
Rnf10 C T 5: 115,242,473 S754N probably damaging Het
Rnf10 T C 5: 115,242,474 S754G probably damaging Het
Sel1l2 A T 2: 140,244,135 V512E probably damaging Het
Shank2 T A 7: 144,031,409 M49K probably benign Het
Sipa1 T C 19: 5,660,523 D153G probably damaging Het
Slc46a2 C T 4: 59,914,279 V215I possibly damaging Het
Slco6c1 G A 1: 97,127,946 L77F probably benign Het
Smarca2 T C 19: 26,647,131 L397P possibly damaging Het
Spg7 C T 8: 123,090,232 A554V probably damaging Het
Stab1 T A 14: 31,143,673 M1753L probably benign Het
Stk11 A G 10: 80,116,618 M1V probably null Het
Supt6 C A 11: 78,232,150 G136C probably damaging Het
Svil G T 18: 5,094,574 R1418L probably damaging Het
Tfg A G 16: 56,701,153 S167P probably benign Het
Timeless T C 10: 128,243,289 V335A probably benign Het
Tll2 C A 19: 41,120,227 R328L probably damaging Het
Tomm7 T C 5: 23,844,061 S5G possibly damaging Het
Ttc39c G A 18: 12,687,081 probably null Het
Ttn T C 2: 76,725,761 E30300G probably benign Het
Tuba4a A T 1: 75,215,697 D452E possibly damaging Het
Tubgcp2 T C 7: 140,008,014 I233V probably benign Het
Tubgcp5 T A 7: 55,806,112 V296E probably damaging Het
Vmn2r53 T C 7: 12,601,056 S226G probably benign Het
Zfhx4 C A 3: 5,396,644 D1192E probably benign Het
Zfp180 G T 7: 24,104,513 W119L possibly damaging Het
Zfp3 A G 11: 70,772,525 I437V probably benign Het
Zfp616 A T 11: 74,085,863 Q986L probably benign Het
Zfp937 T A 2: 150,239,465 C472S probably damaging Het
Other mutations in Xrcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Xrcc6 APN 15 82017200 critical splice donor site probably null
IGL01394:Xrcc6 APN 15 82025661 missense possibly damaging 0.69
IGL01648:Xrcc6 APN 15 82025634 missense probably damaging 0.96
R0312:Xrcc6 UTSW 15 82027222 splice site probably null
R0522:Xrcc6 UTSW 15 82022592 splice site probably benign
R1172:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1173:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1218:Xrcc6 UTSW 15 82022941 missense probably benign 0.00
R1269:Xrcc6 UTSW 15 82022847 missense possibly damaging 0.49
R1677:Xrcc6 UTSW 15 82029699 missense probably benign
R2049:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2140:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2142:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R3737:Xrcc6 UTSW 15 82029631 missense probably damaging 1.00
R3870:Xrcc6 UTSW 15 82025684 missense probably benign 0.16
R3906:Xrcc6 UTSW 15 82029571 missense probably benign 0.01
R4197:Xrcc6 UTSW 15 82029224 missense probably benign 0.06
R4589:Xrcc6 UTSW 15 82022460 missense probably damaging 1.00
R4941:Xrcc6 UTSW 15 82039812 missense probably damaging 1.00
R5318:Xrcc6 UTSW 15 82037507 missense probably damaging 1.00
R5356:Xrcc6 UTSW 15 82029218 missense probably benign 0.00
R5576:Xrcc6 UTSW 15 82022492 missense probably damaging 1.00
R6157:Xrcc6 UTSW 15 82029104 intron probably null
R6596:Xrcc6 UTSW 15 82022954 start codon destroyed probably null 0.58
R6904:Xrcc6 UTSW 15 82029122 missense probably benign 0.19
R6970:Xrcc6 UTSW 15 82031174 missense probably benign 0.03
R7098:Xrcc6 UTSW 15 82035754 nonsense probably null
X0063:Xrcc6 UTSW 15 82022493 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGTTGAGCCAATCTCTAGCTG -3'
(R):5'- GCGCTTTCCTACAGTGTACC -3'

Sequencing Primer
(F):5'- AGCCAATCTCTAGCTGAAGGTTG -3'
(R):5'- TACAGTGTACCCGGACCTATG -3'
Posted On2019-06-26