Incidental Mutation 'R7214:Prr5l'
ID561272
Institutional Source Beutler Lab
Gene Symbol Prr5l
Ensembl Gene ENSMUSG00000032841
Gene Nameproline rich 5 like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R7214 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location101714285-101883027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101729432 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 235 (Y235C)
Ref Sequence ENSEMBL: ENSMUSP00000042167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043845] [ENSMUST00000163762] [ENSMUST00000171088]
Predicted Effect probably benign
Transcript: ENSMUST00000043845
AA Change: Y235C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042167
Gene: ENSMUSG00000032841
AA Change: Y235C

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 47 152 5.4e-15 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000118537
Gene: ENSMUSG00000032841
AA Change: Y163C

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163762
AA Change: Y235C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127530
Gene: ENSMUSG00000032841
AA Change: Y235C

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 177 2.8e-36 PFAM
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171088
AA Change: Y235C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130152
Gene: ENSMUSG00000032841
AA Change: Y235C

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 177 2.8e-36 PFAM
low complexity region 323 332 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 C T 8: 94,934,018 T95I Het
Arap2 C T 5: 62,749,338 V113I probably benign Het
Arntl T A 7: 113,299,403 I346K probably benign Het
Atraid C T 5: 31,052,246 Q85* probably null Het
BC005561 A G 5: 104,522,363 T1584A probably benign Het
Bcdin3d T C 15: 99,470,463 D285G probably benign Het
Carmil3 T C 14: 55,498,612 W604R probably damaging Het
Ccl6 C T 11: 83,589,756 probably null Het
Cct4 C T 11: 22,990,616 probably benign Het
Cd2ap C T 17: 42,845,394 R84Q possibly damaging Het
Cdt1 T A 8: 122,568,273 probably null Het
Cln3 C T 7: 126,582,770 G40D probably damaging Het
Crlf3 T C 11: 80,064,390 S47G possibly damaging Het
Csrp3 T C 7: 48,830,637 K193R probably benign Het
Cxcl3 A C 5: 90,786,360 E33A probably damaging Het
Cyp11b1 T C 15: 74,836,859 D362G probably benign Het
Dnah2 T C 11: 69,431,109 D3795G probably damaging Het
Dnah3 G A 7: 119,922,742 A4076V probably damaging Het
Dnaja3 T A 16: 4,701,182 I380N possibly damaging Het
Dock10 T A 1: 80,568,529 H785L probably benign Het
Dopey2 T G 16: 93,810,135 F2226V possibly damaging Het
Dscaml1 A T 9: 45,670,139 I419F probably benign Het
Dyrk4 T A 6: 126,885,237 I431F probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Endog C T 2: 30,172,890 R181C probably damaging Het
Fam90a1a A T 8: 21,963,625 Y332F probably benign Het
Fastkd3 T C 13: 68,589,380 I588T probably benign Het
Galnt9 G A 5: 110,589,828 V217I probably benign Het
Gm973 A T 1: 59,562,729 R501* probably null Het
Gnptab C T 10: 88,379,157 probably benign Het
Gpn1 T C 5: 31,503,417 F184S probably damaging Het
Imp3 G T 9: 56,937,723 V73L probably benign Het
Ipo11 T C 13: 106,895,857 D259G probably null Het
Jag1 T C 2: 137,106,882 S142G probably benign Het
Klhl5 A T 5: 65,131,755 E120V probably benign Het
Lct C A 1: 128,300,460 V1099L probably benign Het
Lrba G C 3: 86,328,326 W912C probably damaging Het
Lss C T 10: 76,547,471 T535I probably damaging Het
Mcts2 T C 2: 152,687,377 I36T probably benign Het
Meikin T A 11: 54,411,912 N383K probably benign Het
Myo1g T C 11: 6,511,055 Y663C probably damaging Het
Nadk2 T A 15: 9,108,254 M419K probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfat5 T C 8: 107,293,883 S20P probably damaging Het
Nlrp1a C T 11: 71,123,293 C377Y probably damaging Het
Nlrp9a T C 7: 26,551,038 V76A probably damaging Het
Nrap C A 19: 56,378,135 A341S probably benign Het
Ntng2 T C 2: 29,227,720 S239G probably damaging Het
Nup188 T A 2: 30,307,554 C207S possibly damaging Het
Olfr1077-ps1 C T 2: 86,525,806 V124I probably damaging Het
Olfr1328 T A 4: 118,933,949 I300F possibly damaging Het
Olfr1474 T A 19: 13,470,973 M1K probably null Het
Olfr17 T C 7: 107,098,412 *316R probably null Het
Olfr346 T C 2: 36,688,095 I31T probably benign Het
Olfr705 T C 7: 106,874,267 probably benign Het
Olfr891 A C 9: 38,180,022 V267G probably damaging Het
Pcdhgb2 C A 18: 37,690,106 A50E probably damaging Het
Pgap1 A T 1: 54,543,061 M209K possibly damaging Het
Plbd1 T A 6: 136,612,831 D463V probably damaging Het
Plcg2 T A 8: 117,583,549 I380N probably damaging Het
Pnpt1 T C 11: 29,137,285 W184R probably damaging Het
Pptc7 G A 5: 122,313,777 V202I probably benign Het
Prpf6 C T 2: 181,640,596 A510V probably damaging Het
Ptprk T C 10: 28,574,909 V1022A probably benign Het
Rbl2 T C 8: 91,083,429 probably null Het
Rmnd1 T C 10: 4,410,753 K348E probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Sacs T A 14: 61,191,792 N433K probably benign Het
Scyl1 T C 19: 5,760,029 T590A probably benign Het
Sdhd A G 9: 50,597,233 V111A possibly damaging Het
Sec24b G T 3: 130,033,860 P330Q probably benign Het
Serpinb6d C T 13: 33,664,145 P31S probably damaging Het
Slc26a9 A T 1: 131,759,473 R457W probably damaging Het
Slc5a8 G A 10: 88,919,502 M490I probably benign Het
Slx4 A G 16: 3,988,980 I533T probably benign Het
Slx4ip T A 2: 137,046,730 F110L probably benign Het
Smchd1 T C 17: 71,345,364 R2000G probably benign Het
Snx8 T C 5: 140,360,253 E75G possibly damaging Het
Stab2 C A 10: 86,899,841 C1292F probably damaging Het
Swt1 A T 1: 151,394,613 M617K possibly damaging Het
Tiam2 T A 17: 3,518,412 I1611N possibly damaging Het
Tmem63b T G 17: 45,661,822 N682T probably benign Het
Trio C T 15: 27,871,187 V674M probably damaging Het
Trpc3 G A 3: 36,650,137 T557M possibly damaging Het
Vac14 T G 8: 110,671,042 L463R probably damaging Het
Vmn2r43 C T 7: 8,253,380 probably null Het
Wdr49 A T 3: 75,358,444 Y232N possibly damaging Het
Wdr90 T C 17: 25,845,393 M1835V probably benign Het
Xpc T C 6: 91,492,338 E809G probably damaging Het
Zfhx3 A T 8: 108,948,861 Q2181L probably damaging Het
Zfp442 T C 2: 150,409,281 T234A probably benign Het
Zfp764 A T 7: 127,405,278 M227K probably benign Het
Zfp957 A G 14: 79,213,310 S350P unknown Het
Zscan29 T A 2: 121,169,280 K147* probably null Het
Other mutations in Prr5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Prr5l APN 2 101772120 splice site probably benign
IGL02946:Prr5l APN 2 101772184 splice site probably null
PIT4618001:Prr5l UTSW 2 101758530 missense probably damaging 0.99
R0652:Prr5l UTSW 2 101772290 missense possibly damaging 0.94
R0722:Prr5l UTSW 2 101717474 splice site probably benign
R0882:Prr5l UTSW 2 101758541 missense possibly damaging 0.81
R1962:Prr5l UTSW 2 101758509 critical splice donor site probably null
R3013:Prr5l UTSW 2 101734705 missense probably damaging 1.00
R4564:Prr5l UTSW 2 101746749 missense probably damaging 1.00
R4604:Prr5l UTSW 2 101729448 missense probably benign 0.44
R4902:Prr5l UTSW 2 101797682 utr 5 prime probably benign
R5338:Prr5l UTSW 2 101717107 missense probably benign 0.00
R6279:Prr5l UTSW 2 101717420 nonsense probably null
R6792:Prr5l UTSW 2 101717424 missense probably benign 0.00
R7299:Prr5l UTSW 2 101717286 missense probably damaging 1.00
R7301:Prr5l UTSW 2 101717286 missense probably damaging 1.00
X0018:Prr5l UTSW 2 101717259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGGAACCAGTCTCTAAGGAAG -3'
(R):5'- TGGCAGGTGTTGACAAATGTC -3'

Sequencing Primer
(F):5'- CCAGTCTCTAAGGAAGATTGGTAG -3'
(R):5'- CAGGTGTTGACAAATGTCCACTGC -3'
Posted On2019-06-26