Incidental Mutation 'R7214:Slx4ip'
ID561274
Institutional Source Beutler Lab
Gene Symbol Slx4ip
Ensembl Gene ENSMUSG00000027281
Gene NameSLX4 interacting protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7214 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location136891218-137071950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137046730 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 110 (F110L)
Ref Sequence ENSEMBL: ENSMUSP00000096914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028737] [ENSMUST00000099311] [ENSMUST00000180277]
Predicted Effect probably benign
Transcript: ENSMUST00000028737
SMART Domains Protein: ENSMUSP00000028737
Gene: ENSMUSG00000027281

DomainStartEndE-ValueType
low complexity region 271 292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099311
AA Change: F110L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096914
Gene: ENSMUSG00000027281
AA Change: F110L

DomainStartEndE-ValueType
Pfam:UPF0492 10 365 6.4e-170 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180277
AA Change: F110L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136131
Gene: ENSMUSG00000027281
AA Change: F110L

DomainStartEndE-ValueType
low complexity region 341 362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 C T 8: 94,934,018 T95I Het
Arap2 C T 5: 62,749,338 V113I probably benign Het
Arntl T A 7: 113,299,403 I346K probably benign Het
Atraid C T 5: 31,052,246 Q85* probably null Het
BC005561 A G 5: 104,522,363 T1584A probably benign Het
Bcdin3d T C 15: 99,470,463 D285G probably benign Het
Carmil3 T C 14: 55,498,612 W604R probably damaging Het
Ccl6 C T 11: 83,589,756 probably null Het
Cct4 C T 11: 22,990,616 probably benign Het
Cd2ap C T 17: 42,845,394 R84Q possibly damaging Het
Cdt1 T A 8: 122,568,273 probably null Het
Cln3 C T 7: 126,582,770 G40D probably damaging Het
Crlf3 T C 11: 80,064,390 S47G possibly damaging Het
Csrp3 T C 7: 48,830,637 K193R probably benign Het
Cxcl3 A C 5: 90,786,360 E33A probably damaging Het
Cyp11b1 T C 15: 74,836,859 D362G probably benign Het
Dnah2 T C 11: 69,431,109 D3795G probably damaging Het
Dnah3 G A 7: 119,922,742 A4076V probably damaging Het
Dnaja3 T A 16: 4,701,182 I380N possibly damaging Het
Dock10 T A 1: 80,568,529 H785L probably benign Het
Dopey2 T G 16: 93,810,135 F2226V possibly damaging Het
Dscaml1 A T 9: 45,670,139 I419F probably benign Het
Dyrk4 T A 6: 126,885,237 I431F probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Endog C T 2: 30,172,890 R181C probably damaging Het
Fam90a1a A T 8: 21,963,625 Y332F probably benign Het
Fastkd3 T C 13: 68,589,380 I588T probably benign Het
Galnt9 G A 5: 110,589,828 V217I probably benign Het
Gm973 A T 1: 59,562,729 R501* probably null Het
Gnptab C T 10: 88,379,157 probably benign Het
Gpn1 T C 5: 31,503,417 F184S probably damaging Het
Imp3 G T 9: 56,937,723 V73L probably benign Het
Ipo11 T C 13: 106,895,857 D259G probably null Het
Jag1 T C 2: 137,106,882 S142G probably benign Het
Klhl5 A T 5: 65,131,755 E120V probably benign Het
Lct C A 1: 128,300,460 V1099L probably benign Het
Lrba G C 3: 86,328,326 W912C probably damaging Het
Lss C T 10: 76,547,471 T535I probably damaging Het
Mcts2 T C 2: 152,687,377 I36T probably benign Het
Meikin T A 11: 54,411,912 N383K probably benign Het
Myo1g T C 11: 6,511,055 Y663C probably damaging Het
Nadk2 T A 15: 9,108,254 M419K probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfat5 T C 8: 107,293,883 S20P probably damaging Het
Nlrp1a C T 11: 71,123,293 C377Y probably damaging Het
Nlrp9a T C 7: 26,551,038 V76A probably damaging Het
Nrap C A 19: 56,378,135 A341S probably benign Het
Ntng2 T C 2: 29,227,720 S239G probably damaging Het
Nup188 T A 2: 30,307,554 C207S possibly damaging Het
Olfr1077-ps1 C T 2: 86,525,806 V124I probably damaging Het
Olfr1328 T A 4: 118,933,949 I300F possibly damaging Het
Olfr1474 T A 19: 13,470,973 M1K probably null Het
Olfr17 T C 7: 107,098,412 *316R probably null Het
Olfr346 T C 2: 36,688,095 I31T probably benign Het
Olfr705 T C 7: 106,874,267 probably benign Het
Olfr891 A C 9: 38,180,022 V267G probably damaging Het
Pcdhgb2 C A 18: 37,690,106 A50E probably damaging Het
Pgap1 A T 1: 54,543,061 M209K possibly damaging Het
Plbd1 T A 6: 136,612,831 D463V probably damaging Het
Plcg2 T A 8: 117,583,549 I380N probably damaging Het
Pnpt1 T C 11: 29,137,285 W184R probably damaging Het
Pptc7 G A 5: 122,313,777 V202I probably benign Het
Prpf6 C T 2: 181,640,596 A510V probably damaging Het
Prr5l T C 2: 101,729,432 Y235C probably benign Het
Ptprk T C 10: 28,574,909 V1022A probably benign Het
Rbl2 T C 8: 91,083,429 probably null Het
Rmnd1 T C 10: 4,410,753 K348E probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Sacs T A 14: 61,191,792 N433K probably benign Het
Scyl1 T C 19: 5,760,029 T590A probably benign Het
Sdhd A G 9: 50,597,233 V111A possibly damaging Het
Sec24b G T 3: 130,033,860 P330Q probably benign Het
Serpinb6d C T 13: 33,664,145 P31S probably damaging Het
Slc26a9 A T 1: 131,759,473 R457W probably damaging Het
Slc5a8 G A 10: 88,919,502 M490I probably benign Het
Slx4 A G 16: 3,988,980 I533T probably benign Het
Smchd1 T C 17: 71,345,364 R2000G probably benign Het
Snx8 T C 5: 140,360,253 E75G possibly damaging Het
Stab2 C A 10: 86,899,841 C1292F probably damaging Het
Swt1 A T 1: 151,394,613 M617K possibly damaging Het
Tiam2 T A 17: 3,518,412 I1611N possibly damaging Het
Tmem63b T G 17: 45,661,822 N682T probably benign Het
Trio C T 15: 27,871,187 V674M probably damaging Het
Trpc3 G A 3: 36,650,137 T557M possibly damaging Het
Vac14 T G 8: 110,671,042 L463R probably damaging Het
Vmn2r43 C T 7: 8,253,380 probably null Het
Wdr49 A T 3: 75,358,444 Y232N possibly damaging Het
Wdr90 T C 17: 25,845,393 M1835V probably benign Het
Xpc T C 6: 91,492,338 E809G probably damaging Het
Zfhx3 A T 8: 108,948,861 Q2181L probably damaging Het
Zfp442 T C 2: 150,409,281 T234A probably benign Het
Zfp764 A T 7: 127,405,278 M227K probably benign Het
Zfp957 A G 14: 79,213,310 S350P unknown Het
Zscan29 T A 2: 121,169,280 K147* probably null Het
Other mutations in Slx4ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Slx4ip APN 2 137044055 nonsense probably null
IGL01546:Slx4ip APN 2 137066199 missense probably benign
IGL02114:Slx4ip APN 2 137000200 missense probably damaging 1.00
IGL02142:Slx4ip APN 2 137068022 missense possibly damaging 0.87
IGL02253:Slx4ip APN 2 137000275 critical splice donor site probably null
IGL02826:Slx4ip APN 2 137004973 missense probably damaging 1.00
IGL03035:Slx4ip APN 2 137067703 missense possibly damaging 0.50
IGL03261:Slx4ip APN 2 137046739 missense probably benign 0.01
R0561:Slx4ip UTSW 2 137066170 missense probably null 0.27
R1750:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R1774:Slx4ip UTSW 2 137067723 missense probably damaging 0.99
R1812:Slx4ip UTSW 2 137068195 missense probably benign 0.13
R1894:Slx4ip UTSW 2 137068118 missense probably benign 0.02
R1961:Slx4ip UTSW 2 137067681 missense probably benign 0.02
R2051:Slx4ip UTSW 2 137066205 missense possibly damaging 0.90
R2263:Slx4ip UTSW 2 137044015 missense probably damaging 1.00
R2914:Slx4ip UTSW 2 137067591 critical splice acceptor site probably null
R3798:Slx4ip UTSW 2 137067623 missense probably benign 0.19
R4061:Slx4ip UTSW 2 137005017 missense probably benign 0.08
R4934:Slx4ip UTSW 2 137068347 utr 3 prime probably benign
R4944:Slx4ip UTSW 2 137046767 missense probably benign 0.17
R5061:Slx4ip UTSW 2 137044010 missense probably damaging 1.00
R5465:Slx4ip UTSW 2 137004947 missense probably damaging 1.00
R5609:Slx4ip UTSW 2 137000242 missense probably damaging 1.00
R6112:Slx4ip UTSW 2 137046744 missense probably damaging 1.00
R6391:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R6525:Slx4ip UTSW 2 137000218 missense possibly damaging 0.72
R6868:Slx4ip UTSW 2 137000210 missense probably damaging 1.00
R6944:Slx4ip UTSW 2 137068275 missense probably damaging 1.00
R6966:Slx4ip UTSW 2 137068224 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAACTCACTCTGCCCAAGTG -3'
(R):5'- CTGCTGATAATAAAAGACACCCTGG -3'

Sequencing Primer
(F):5'- CAAGTGGTGGAAATCTTGTAGAG -3'
(R):5'- TGATAATAAAAGACACCCTGGAACAC -3'
Posted On2019-06-26