Incidental Mutation 'R7214:Arntl'
ID561302
Institutional Source Beutler Lab
Gene Symbol Arntl
Ensembl Gene ENSMUSG00000055116
Gene Namearyl hydrocarbon receptor nuclear translocator-like
SynonymsBmal1, MOP3, bHLHe5, Arnt3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R7214 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location113207465-113314126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113299403 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 346 (I346K)
Ref Sequence ENSEMBL: ENSMUSP00000046235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047321] [ENSMUST00000210074] [ENSMUST00000210238] [ENSMUST00000211770]
Predicted Effect probably benign
Transcript: ENSMUST00000047321
AA Change: I346K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046235
Gene: ENSMUSG00000055116
AA Change: I346K

DomainStartEndE-ValueType
HLH 78 131 2.92e-16 SMART
PAS 146 213 4.41e-12 SMART
PAS 328 394 1.66e-7 SMART
PAC 401 444 2.92e-3 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210074
AA Change: I333K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000210238
AA Change: I346K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000211770
AA Change: I353K

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a basic helix-loop-helix protein that forms a heterodimer with Clock. This heterodimer binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Defects in this gene have been linked to infertility, problems with gluconeogenesis and lipogenesis, and altered sleep patterns. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in abnormal light/dark cycle activity and decreases overall activity levels. Mice homozygous for another knock-out allele exhibit loss of circadian rhythm in locomotor activity, dyslipidemia, ectopic fat formationand altered energy homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 C T 8: 94,934,018 T95I Het
Arap2 C T 5: 62,749,338 V113I probably benign Het
Atraid C T 5: 31,052,246 Q85* probably null Het
BC005561 A G 5: 104,522,363 T1584A probably benign Het
Bcdin3d T C 15: 99,470,463 D285G probably benign Het
Carmil3 T C 14: 55,498,612 W604R probably damaging Het
Ccl6 C T 11: 83,589,756 probably null Het
Cct4 C T 11: 22,990,616 probably benign Het
Cd2ap C T 17: 42,845,394 R84Q possibly damaging Het
Cdt1 T A 8: 122,568,273 probably null Het
Cln3 C T 7: 126,582,770 G40D probably damaging Het
Crlf3 T C 11: 80,064,390 S47G possibly damaging Het
Csrp3 T C 7: 48,830,637 K193R probably benign Het
Cxcl3 A C 5: 90,786,360 E33A probably damaging Het
Cyp11b1 T C 15: 74,836,859 D362G probably benign Het
Dnah2 T C 11: 69,431,109 D3795G probably damaging Het
Dnah3 G A 7: 119,922,742 A4076V probably damaging Het
Dnaja3 T A 16: 4,701,182 I380N possibly damaging Het
Dock10 T A 1: 80,568,529 H785L probably benign Het
Dopey2 T G 16: 93,810,135 F2226V possibly damaging Het
Dscaml1 A T 9: 45,670,139 I419F probably benign Het
Dyrk4 T A 6: 126,885,237 I431F probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Endog C T 2: 30,172,890 R181C probably damaging Het
Fam90a1a A T 8: 21,963,625 Y332F probably benign Het
Fastkd3 T C 13: 68,589,380 I588T probably benign Het
Galnt9 G A 5: 110,589,828 V217I probably benign Het
Gm973 A T 1: 59,562,729 R501* probably null Het
Gnptab C T 10: 88,379,157 probably benign Het
Gpn1 T C 5: 31,503,417 F184S probably damaging Het
Imp3 G T 9: 56,937,723 V73L probably benign Het
Ipo11 T C 13: 106,895,857 D259G probably null Het
Jag1 T C 2: 137,106,882 S142G probably benign Het
Klhl5 A T 5: 65,131,755 E120V probably benign Het
Lct C A 1: 128,300,460 V1099L probably benign Het
Lrba G C 3: 86,328,326 W912C probably damaging Het
Lss C T 10: 76,547,471 T535I probably damaging Het
Mcts2 T C 2: 152,687,377 I36T probably benign Het
Meikin T A 11: 54,411,912 N383K probably benign Het
Myo1g T C 11: 6,511,055 Y663C probably damaging Het
Nadk2 T A 15: 9,108,254 M419K probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfat5 T C 8: 107,293,883 S20P probably damaging Het
Nlrp1a C T 11: 71,123,293 C377Y probably damaging Het
Nlrp9a T C 7: 26,551,038 V76A probably damaging Het
Nrap C A 19: 56,378,135 A341S probably benign Het
Ntng2 T C 2: 29,227,720 S239G probably damaging Het
Nup188 T A 2: 30,307,554 C207S possibly damaging Het
Olfr1077-ps1 C T 2: 86,525,806 V124I probably damaging Het
Olfr1328 T A 4: 118,933,949 I300F possibly damaging Het
Olfr1474 T A 19: 13,470,973 M1K probably null Het
Olfr17 T C 7: 107,098,412 *316R probably null Het
Olfr346 T C 2: 36,688,095 I31T probably benign Het
Olfr705 T C 7: 106,874,267 probably benign Het
Olfr891 A C 9: 38,180,022 V267G probably damaging Het
Pcdhgb2 C A 18: 37,690,106 A50E probably damaging Het
Pgap1 A T 1: 54,543,061 M209K possibly damaging Het
Plbd1 T A 6: 136,612,831 D463V probably damaging Het
Plcg2 T A 8: 117,583,549 I380N probably damaging Het
Pnpt1 T C 11: 29,137,285 W184R probably damaging Het
Pptc7 G A 5: 122,313,777 V202I probably benign Het
Prpf6 C T 2: 181,640,596 A510V probably damaging Het
Prr5l T C 2: 101,729,432 Y235C probably benign Het
Ptprk T C 10: 28,574,909 V1022A probably benign Het
Rbl2 T C 8: 91,083,429 probably null Het
Rmnd1 T C 10: 4,410,753 K348E probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Sacs T A 14: 61,191,792 N433K probably benign Het
Scyl1 T C 19: 5,760,029 T590A probably benign Het
Sdhd A G 9: 50,597,233 V111A possibly damaging Het
Sec24b G T 3: 130,033,860 P330Q probably benign Het
Serpinb6d C T 13: 33,664,145 P31S probably damaging Het
Slc26a9 A T 1: 131,759,473 R457W probably damaging Het
Slc5a8 G A 10: 88,919,502 M490I probably benign Het
Slx4 A G 16: 3,988,980 I533T probably benign Het
Slx4ip T A 2: 137,046,730 F110L probably benign Het
Smchd1 T C 17: 71,345,364 R2000G probably benign Het
Snx8 T C 5: 140,360,253 E75G possibly damaging Het
Stab2 C A 10: 86,899,841 C1292F probably damaging Het
Swt1 A T 1: 151,394,613 M617K possibly damaging Het
Tiam2 T A 17: 3,518,412 I1611N possibly damaging Het
Tmem63b T G 17: 45,661,822 N682T probably benign Het
Trio C T 15: 27,871,187 V674M probably damaging Het
Trpc3 G A 3: 36,650,137 T557M possibly damaging Het
Vac14 T G 8: 110,671,042 L463R probably damaging Het
Vmn2r43 C T 7: 8,253,380 probably null Het
Wdr49 A T 3: 75,358,444 Y232N possibly damaging Het
Wdr90 T C 17: 25,845,393 M1835V probably benign Het
Xpc T C 6: 91,492,338 E809G probably damaging Het
Zfhx3 A T 8: 108,948,861 Q2181L probably damaging Het
Zfp442 T C 2: 150,409,281 T234A probably benign Het
Zfp764 A T 7: 127,405,278 M227K probably benign Het
Zfp957 A G 14: 79,213,310 S350P unknown Het
Zscan29 T A 2: 121,169,280 K147* probably null Het
Other mutations in Arntl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Arntl APN 7 113303407 missense probably damaging 0.99
diet UTSW 7 113285031 missense probably damaging 1.00
R0308:Arntl UTSW 7 113291536 missense probably damaging 1.00
R2039:Arntl UTSW 7 113285112 missense probably damaging 1.00
R3548:Arntl UTSW 7 113313545 missense probably damaging 1.00
R4355:Arntl UTSW 7 113303406 missense possibly damaging 0.46
R4718:Arntl UTSW 7 113303361 missense probably damaging 0.98
R4725:Arntl UTSW 7 113304359 missense possibly damaging 0.82
R4776:Arntl UTSW 7 113285037 missense probably damaging 1.00
R4920:Arntl UTSW 7 113285114 missense probably damaging 1.00
R4960:Arntl UTSW 7 113299435 critical splice donor site probably null
R4985:Arntl UTSW 7 113285073 missense probably damaging 1.00
R5640:Arntl UTSW 7 113308681 missense probably damaging 1.00
R5739:Arntl UTSW 7 113285031 missense probably damaging 1.00
R6004:Arntl UTSW 7 113280727 missense probably damaging 0.97
R7201:Arntl UTSW 7 113285142 missense probably damaging 1.00
R7218:Arntl UTSW 7 113287183 missense probably damaging 0.96
R7378:Arntl UTSW 7 113299208 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TTTGAAAAGCTGGCCACCC -3'
(R):5'- CTCTTAGAAAAGCCAGCTGACC -3'

Sequencing Primer
(F):5'- TGGCCACCCACGAAGATG -3'
(R):5'- TAAATCCTCTGCCACAGTGG -3'
Posted On2019-06-26