Incidental Mutation 'R7214:Plcg2'
ID561313
Institutional Source Beutler Lab
Gene Symbol Plcg2
Ensembl Gene ENSMUSG00000034330
Gene Namephospholipase C, gamma 2
SynonymsPlcg-2, PLCgamma2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7214 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location117498291-117635142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117583549 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 380 (I380N)
Ref Sequence ENSEMBL: ENSMUSP00000079991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081232]
PDB Structure
Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000081232
AA Change: I380N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079991
Gene: ENSMUSG00000034330
AA Change: I380N

DomainStartEndE-ValueType
PH 21 133 1.87e-4 SMART
PLCXc 312 456 2.29e-96 SMART
low complexity region 461 476 N/A INTRINSIC
PDB:2K2J|A 478 516 6e-17 PDB
SH2 530 623 2.24e-30 SMART
SH2 644 726 1.16e-28 SMART
SH3 772 828 3.12e-18 SMART
PH 789 910 4.31e0 SMART
PLCYc 930 1044 1.18e-66 SMART
C2 1062 1167 1.41e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 C T 8: 94,934,018 T95I Het
Arap2 C T 5: 62,749,338 V113I probably benign Het
Arntl T A 7: 113,299,403 I346K probably benign Het
Atraid C T 5: 31,052,246 Q85* probably null Het
BC005561 A G 5: 104,522,363 T1584A probably benign Het
Bcdin3d T C 15: 99,470,463 D285G probably benign Het
Carmil3 T C 14: 55,498,612 W604R probably damaging Het
Ccl6 C T 11: 83,589,756 probably null Het
Cct4 C T 11: 22,990,616 probably benign Het
Cd2ap C T 17: 42,845,394 R84Q possibly damaging Het
Cdt1 T A 8: 122,568,273 probably null Het
Cln3 C T 7: 126,582,770 G40D probably damaging Het
Crlf3 T C 11: 80,064,390 S47G possibly damaging Het
Csrp3 T C 7: 48,830,637 K193R probably benign Het
Cxcl3 A C 5: 90,786,360 E33A probably damaging Het
Cyp11b1 T C 15: 74,836,859 D362G probably benign Het
Dnah2 T C 11: 69,431,109 D3795G probably damaging Het
Dnah3 G A 7: 119,922,742 A4076V probably damaging Het
Dnaja3 T A 16: 4,701,182 I380N possibly damaging Het
Dock10 T A 1: 80,568,529 H785L probably benign Het
Dopey2 T G 16: 93,810,135 F2226V possibly damaging Het
Dscaml1 A T 9: 45,670,139 I419F probably benign Het
Dyrk4 T A 6: 126,885,237 I431F probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Endog C T 2: 30,172,890 R181C probably damaging Het
Fam90a1a A T 8: 21,963,625 Y332F probably benign Het
Fastkd3 T C 13: 68,589,380 I588T probably benign Het
Galnt9 G A 5: 110,589,828 V217I probably benign Het
Gm973 A T 1: 59,562,729 R501* probably null Het
Gnptab C T 10: 88,379,157 probably benign Het
Gpn1 T C 5: 31,503,417 F184S probably damaging Het
Imp3 G T 9: 56,937,723 V73L probably benign Het
Ipo11 T C 13: 106,895,857 D259G probably null Het
Jag1 T C 2: 137,106,882 S142G probably benign Het
Klhl5 A T 5: 65,131,755 E120V probably benign Het
Lct C A 1: 128,300,460 V1099L probably benign Het
Lrba G C 3: 86,328,326 W912C probably damaging Het
Lss C T 10: 76,547,471 T535I probably damaging Het
Mcts2 T C 2: 152,687,377 I36T probably benign Het
Meikin T A 11: 54,411,912 N383K probably benign Het
Myo1g T C 11: 6,511,055 Y663C probably damaging Het
Nadk2 T A 15: 9,108,254 M419K probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfat5 T C 8: 107,293,883 S20P probably damaging Het
Nlrp1a C T 11: 71,123,293 C377Y probably damaging Het
Nlrp9a T C 7: 26,551,038 V76A probably damaging Het
Nrap C A 19: 56,378,135 A341S probably benign Het
Ntng2 T C 2: 29,227,720 S239G probably damaging Het
Nup188 T A 2: 30,307,554 C207S possibly damaging Het
Olfr1077-ps1 C T 2: 86,525,806 V124I probably damaging Het
Olfr1328 T A 4: 118,933,949 I300F possibly damaging Het
Olfr1474 T A 19: 13,470,973 M1K probably null Het
Olfr17 T C 7: 107,098,412 *316R probably null Het
Olfr346 T C 2: 36,688,095 I31T probably benign Het
Olfr705 T C 7: 106,874,267 probably benign Het
Olfr891 A C 9: 38,180,022 V267G probably damaging Het
Pcdhgb2 C A 18: 37,690,106 A50E probably damaging Het
Pgap1 A T 1: 54,543,061 M209K possibly damaging Het
Plbd1 T A 6: 136,612,831 D463V probably damaging Het
Pnpt1 T C 11: 29,137,285 W184R probably damaging Het
Pptc7 G A 5: 122,313,777 V202I probably benign Het
Prpf6 C T 2: 181,640,596 A510V probably damaging Het
Prr5l T C 2: 101,729,432 Y235C probably benign Het
Ptprk T C 10: 28,574,909 V1022A probably benign Het
Rbl2 T C 8: 91,083,429 probably null Het
Rmnd1 T C 10: 4,410,753 K348E probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Sacs T A 14: 61,191,792 N433K probably benign Het
Scyl1 T C 19: 5,760,029 T590A probably benign Het
Sdhd A G 9: 50,597,233 V111A possibly damaging Het
Sec24b G T 3: 130,033,860 P330Q probably benign Het
Serpinb6d C T 13: 33,664,145 P31S probably damaging Het
Slc26a9 A T 1: 131,759,473 R457W probably damaging Het
Slc5a8 G A 10: 88,919,502 M490I probably benign Het
Slx4 A G 16: 3,988,980 I533T probably benign Het
Slx4ip T A 2: 137,046,730 F110L probably benign Het
Smchd1 T C 17: 71,345,364 R2000G probably benign Het
Snx8 T C 5: 140,360,253 E75G possibly damaging Het
Stab2 C A 10: 86,899,841 C1292F probably damaging Het
Swt1 A T 1: 151,394,613 M617K possibly damaging Het
Tiam2 T A 17: 3,518,412 I1611N possibly damaging Het
Tmem63b T G 17: 45,661,822 N682T probably benign Het
Trio C T 15: 27,871,187 V674M probably damaging Het
Trpc3 G A 3: 36,650,137 T557M possibly damaging Het
Vac14 T G 8: 110,671,042 L463R probably damaging Het
Vmn2r43 C T 7: 8,253,380 probably null Het
Wdr49 A T 3: 75,358,444 Y232N possibly damaging Het
Wdr90 T C 17: 25,845,393 M1835V probably benign Het
Xpc T C 6: 91,492,338 E809G probably damaging Het
Zfhx3 A T 8: 108,948,861 Q2181L probably damaging Het
Zfp442 T C 2: 150,409,281 T234A probably benign Het
Zfp764 A T 7: 127,405,278 M227K probably benign Het
Zfp957 A G 14: 79,213,310 S350P unknown Het
Zscan29 T A 2: 121,169,280 K147* probably null Het
Other mutations in Plcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Plcg2 APN 8 117556071 missense possibly damaging 0.89
IGL00911:Plcg2 APN 8 117586515 missense probably benign 0.17
IGL00952:Plcg2 APN 8 117607217 missense probably benign
IGL01115:Plcg2 APN 8 117557329 missense probably damaging 1.00
IGL01326:Plcg2 APN 8 117573999 splice site probably benign
IGL01357:Plcg2 APN 8 117614161 splice site probably benign
IGL01705:Plcg2 APN 8 117581662 missense probably damaging 1.00
IGL01755:Plcg2 APN 8 117621241 missense possibly damaging 0.48
IGL01828:Plcg2 APN 8 117590233 missense probably damaging 1.00
IGL02307:Plcg2 APN 8 117579896 critical splice donor site probably null
IGL02345:Plcg2 APN 8 117585180 missense probably damaging 0.99
IGL02448:Plcg2 APN 8 117607221 missense probably benign
IGL02587:Plcg2 APN 8 117558113 missense possibly damaging 0.80
IGL02646:Plcg2 APN 8 117603883 missense possibly damaging 0.88
IGL03409:Plcg2 APN 8 117583495 missense probably damaging 0.96
Poseidon UTSW 8 117615238 missense probably damaging 1.00
Poseidon2 UTSW 8 117577874 missense possibly damaging 0.80
queen UTSW 8 117581707 missense probably benign 0.00
seahorse UTSW 8 117589835 splice site probably null
Theseus UTSW 8 117596332 missense probably damaging 0.99
trident UTSW 8 117612978 missense probably benign 0.00
R0172:Plcg2 UTSW 8 117579782 missense probably benign 0.00
R0194:Plcg2 UTSW 8 117573397 splice site probably benign
R0410:Plcg2 UTSW 8 117615373 missense probably damaging 0.98
R0462:Plcg2 UTSW 8 117585305 missense probably benign 0.06
R0494:Plcg2 UTSW 8 117556104 missense probably damaging 1.00
R0522:Plcg2 UTSW 8 117614288 splice site probably null
R0612:Plcg2 UTSW 8 117573365 missense probably benign 0.01
R1239:Plcg2 UTSW 8 117556044 missense probably benign
R1367:Plcg2 UTSW 8 117615238 missense probably damaging 1.00
R1608:Plcg2 UTSW 8 117614235 missense possibly damaging 0.89
R1756:Plcg2 UTSW 8 117592708 missense probably benign 0.02
R2176:Plcg2 UTSW 8 117612994 missense probably damaging 1.00
R3500:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4043:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4654:Plcg2 UTSW 8 117504315 missense probably benign
R4883:Plcg2 UTSW 8 117607133 nonsense probably null
R4932:Plcg2 UTSW 8 117607083 missense probably benign 0.05
R5080:Plcg2 UTSW 8 117590003 missense probably benign 0.10
R5226:Plcg2 UTSW 8 117577874 missense possibly damaging 0.80
R5264:Plcg2 UTSW 8 117634793 missense possibly damaging 0.95
R5298:Plcg2 UTSW 8 117605249 missense probably benign
R5473:Plcg2 UTSW 8 117634401 missense probably benign
R5555:Plcg2 UTSW 8 117612995 nonsense probably null
R5557:Plcg2 UTSW 8 117586557 missense probably damaging 0.99
R5805:Plcg2 UTSW 8 117598495 critical splice donor site probably null
R5826:Plcg2 UTSW 8 117610844 missense probably benign 0.19
R5871:Plcg2 UTSW 8 117504217 missense probably damaging 1.00
R5894:Plcg2 UTSW 8 117504349 missense probably damaging 0.99
R6142:Plcg2 UTSW 8 117585271 missense probably benign
R6609:Plcg2 UTSW 8 117568170 missense probably benign 0.31
R6684:Plcg2 UTSW 8 117596332 missense probably damaging 0.99
R6710:Plcg2 UTSW 8 117557347 missense probably benign 0.05
R6931:Plcg2 UTSW 8 117557319 missense probably benign 0.24
R6946:Plcg2 UTSW 8 117504190 missense probably benign
R7036:Plcg2 UTSW 8 117596306 missense probably benign
R7070:Plcg2 UTSW 8 117596306 missense probably benign
R7072:Plcg2 UTSW 8 117589835 splice site probably null
R7351:Plcg2 UTSW 8 117590310 missense possibly damaging 0.95
R7393:Plcg2 UTSW 8 117579825 missense possibly damaging 0.90
X0027:Plcg2 UTSW 8 117555983 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCATGGATGTGTGGGTGAAC -3'
(R):5'- AGCCAAATGGAGTCCAAGC -3'

Sequencing Primer
(F):5'- TCAGCCTTGGGAACAGAGC -3'
(R):5'- AAGCTCCCCCAGGCTTTG -3'
Posted On2019-06-26