Incidental Mutation 'R7215:Atg9b'
ID561375
Institutional Source Beutler Lab
Gene Symbol Atg9b
Ensembl Gene ENSMUSG00000038295
Gene Nameautophagy related 9B
SynonymsLOC213948, Apg9l2, Nos3as, eONE
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7215 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location24384181-24392143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24388041 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 455 (W455G)
Ref Sequence ENSEMBL: ENSMUSP00000051864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000059401] [ENSMUST00000115090]
Predicted Effect probably benign
Transcript: ENSMUST00000030834
SMART Domains Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 118 480 1.7e-183 PFAM
Pfam:Flavodoxin_1 521 697 4.8e-54 PFAM
Pfam:FAD_binding_1 750 978 2.1e-82 PFAM
Pfam:NAD_binding_1 1010 1124 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059401
AA Change: W455G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051864
Gene: ENSMUSG00000038295
AA Change: W455G

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 22 38 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
transmembrane domain 279 296 N/A INTRINSIC
Pfam:APG9 321 681 1.2e-100 PFAM
low complexity region 782 799 N/A INTRINSIC
low complexity region 838 847 N/A INTRINSIC
low complexity region 854 871 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115090
SMART Domains Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 114 485 9e-214 PFAM
Pfam:Flavodoxin_1 521 697 3.8e-54 PFAM
Pfam:FAD_binding_1 750 978 1.6e-79 PFAM
Pfam:NAD_binding_1 1010 1091 5.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions in the regulation of autophagy, a lysosomal degradation pathway. This gene also functions as an antisense transcript in the posttranscriptional regulation of the endothelial nitric oxide synthase 3 gene, which has 3' overlap with this gene on the opposite strand. Mutations in this gene and disruption of the autophagy process have been associated with multiple cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Atg9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Atg9b APN 5 24386515 unclassified probably null
IGL02020:Atg9b APN 5 24391058 missense possibly damaging 0.89
PIT4418001:Atg9b UTSW 5 24385515 missense possibly damaging 0.93
R0045:Atg9b UTSW 5 24387398 missense probably damaging 0.99
R1698:Atg9b UTSW 5 24388188 missense probably damaging 1.00
R1807:Atg9b UTSW 5 24387057 missense probably damaging 1.00
R1885:Atg9b UTSW 5 24388254 missense probably damaging 1.00
R2183:Atg9b UTSW 5 24390493 missense probably benign 0.01
R2224:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2226:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2227:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2426:Atg9b UTSW 5 24386994 missense probably damaging 1.00
R2919:Atg9b UTSW 5 24391544 missense possibly damaging 0.66
R3003:Atg9b UTSW 5 24391219 missense probably damaging 1.00
R4772:Atg9b UTSW 5 24385239 makesense probably null
R4786:Atg9b UTSW 5 24386089 missense possibly damaging 0.92
R5901:Atg9b UTSW 5 24392019 unclassified probably benign
R6410:Atg9b UTSW 5 24386110 missense possibly damaging 0.46
R6505:Atg9b UTSW 5 24390577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGATGGTGAGCACTAGCAGC -3'
(R):5'- AACGTGGACTTGCTGCTCTTC -3'

Sequencing Primer
(F):5'- TCCCGAGAAGAAGACCAGCTG -3'
(R):5'- GCTGCTCTTCCGCGGTC -3'
Posted On2019-06-26