Incidental Mutation 'R7215:Edil3'
ID561413
Institutional Source Beutler Lab
Gene Symbol Edil3
Ensembl Gene ENSMUSG00000034488
Gene NameEGF-like repeats and discoidin I-like domains 3
SynonymsDel-1, developmental endothelial locus-1, Del1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7215 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location88821472-89323223 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 88822050 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043111] [ENSMUST00000081769] [ENSMUST00000118731]
Predicted Effect probably null
Transcript: ENSMUST00000043111
SMART Domains Protein: ENSMUSP00000044652
Gene: ENSMUSG00000034488

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 67 107 1.62e-5 SMART
EGF_CA 109 145 4.32e-10 SMART
FA58C 147 304 3.7e-58 SMART
FA58C 308 466 1.44e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081769
SMART Domains Protein: ENSMUSP00000080462
Gene: ENSMUSG00000034488

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 77 117 1.62e-5 SMART
EGF_CA 119 155 4.32e-10 SMART
FA58C 157 314 3.7e-58 SMART
FA58C 318 476 1.44e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118731
SMART Domains Protein: ENSMUSP00000112829
Gene: ENSMUSG00000034488

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 77 117 1.62e-5 SMART
EGF_CA 119 155 4.32e-10 SMART
FA58C 157 314 3.7e-58 SMART
SCOP:d1d7pm_ 316 380 4e-20 SMART
Blast:FA58C 319 380 2e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integrin ligand. It plays an important role in mediating angiogenesis and may be important in vessel wall remodeling and development. It also influences endothelial cell behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no noticeable fur phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Edil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Edil3 APN 13 89289533 missense probably benign 0.40
IGL01628:Edil3 APN 13 89319826 utr 3 prime probably benign
IGL02112:Edil3 APN 13 89180255 missense probably damaging 1.00
IGL03123:Edil3 APN 13 89131736 missense probably damaging 1.00
R0402:Edil3 UTSW 13 89199451 splice site probably benign
R0608:Edil3 UTSW 13 89184849 missense probably damaging 1.00
R0675:Edil3 UTSW 13 89177280 missense probably damaging 0.96
R0735:Edil3 UTSW 13 89177178 missense probably damaging 0.97
R0991:Edil3 UTSW 13 89289506 nonsense probably null
R1507:Edil3 UTSW 13 89131712 missense probably damaging 1.00
R1643:Edil3 UTSW 13 89289576 critical splice donor site probably null
R2008:Edil3 UTSW 13 88944953 splice site probably null
R3703:Edil3 UTSW 13 89177298 missense probably benign 0.01
R4206:Edil3 UTSW 13 89180278 missense probably damaging 1.00
R4258:Edil3 UTSW 13 89177153 missense probably damaging 1.00
R4570:Edil3 UTSW 13 89131897 intron probably benign
R4575:Edil3 UTSW 13 89319731 missense probably damaging 1.00
R4576:Edil3 UTSW 13 89319731 missense probably damaging 1.00
R4654:Edil3 UTSW 13 89289470 missense probably damaging 1.00
R5420:Edil3 UTSW 13 89131772 missense probably damaging 1.00
R5446:Edil3 UTSW 13 89184838 missense possibly damaging 0.65
R5534:Edil3 UTSW 13 89199474 missense probably benign 0.00
R5653:Edil3 UTSW 13 89131812 missense probably damaging 1.00
R5663:Edil3 UTSW 13 89042508 missense probably damaging 0.99
R5664:Edil3 UTSW 13 89319713 missense probably damaging 1.00
R6179:Edil3 UTSW 13 88821989 missense probably benign
R6254:Edil3 UTSW 13 89319729 missense probably damaging 1.00
R6813:Edil3 UTSW 13 89289456 missense probably damaging 1.00
R7138:Edil3 UTSW 13 89131728 missense probably damaging 1.00
R7295:Edil3 UTSW 13 89131783 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATCGCCCTTCCCAAGAATTTGAG -3'
(R):5'- TCCACACGGACTTTGCTAGC -3'

Sequencing Primer
(F):5'- GGAAAGACGTCCTCTTGAATCTCTG -3'
(R):5'- CTAGCACTTTGGCAGGGTATCC -3'
Posted On2019-06-26