Incidental Mutation 'R7216:Rictor'
ID561506
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene NameRPTOR independent companion of MTOR, complex 2
SynonymsD530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7216 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location6708379-6800401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6769301 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 343 (T343M)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
Predicted Effect probably damaging
Transcript: ENSMUST00000061656
AA Change: T343M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: T343M

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228918
Meta Mutation Damage Score 0.0356 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,140,457 N1551K probably benign Het
Amy2a1 T C 3: 113,530,441 D150G possibly damaging Het
Atp2b1 T A 10: 98,986,977 C165S probably benign Het
Atp2c1 A T 9: 105,467,731 D102E probably benign Het
Capn8 C A 1: 182,598,798 R233S possibly damaging Het
Cd48 T C 1: 171,695,822 S78P probably damaging Het
Clasp1 T A 1: 118,547,918 D944E probably benign Het
Clip2 A G 5: 134,502,917 M678T probably benign Het
Clmp T C 9: 40,760,909 Y12H possibly damaging Het
Col22a1 A T 15: 71,973,845 V356D probably damaging Het
Copg2 A T 6: 30,885,600 D101E probably damaging Het
Cpsf6 G A 10: 117,362,023 P229S unknown Het
Dgke T C 11: 89,050,337 D340G probably benign Het
Dlg1 TAAA TAA 16: 31,796,918 probably null Het
Dlg5 G A 14: 24,136,638 Q1865* probably null Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Egln2 T C 7: 27,159,829 D365G probably damaging Het
Epha4 T C 1: 77,444,984 D287G probably damaging Het
Fat4 A G 3: 38,891,043 T1362A probably damaging Het
Flt4 A G 11: 49,634,681 T685A possibly damaging Het
Fras1 T C 5: 96,739,314 Y2652H probably damaging Het
Gas2 A G 7: 51,897,257 E52G possibly damaging Het
Gm11639 A T 11: 104,880,549 K2633N possibly damaging Het
Gm13103 A G 4: 143,851,829 I220V probably damaging Het
Gm5093 A T 17: 46,440,088 D4E not run Het
Gm6370 A T 5: 146,493,913 T303S probably benign Het
Gpr161 A G 1: 165,306,546 I126V probably benign Het
Gpr63 T C 4: 25,008,038 L254P probably damaging Het
H2-M9 C T 17: 36,640,702 V294I probably benign Het
Insr T A 8: 3,203,034 N375I possibly damaging Het
Ints1 T C 5: 139,768,984 N600S possibly damaging Het
Ints10 A G 8: 68,822,157 N628S probably damaging Het
Irf2 A G 8: 46,793,556 T20A probably benign Het
Irs1 T A 1: 82,289,755 T247S probably damaging Het
Islr C T 9: 58,156,967 S419N unknown Het
Kcna2 T A 3: 107,104,793 I230N probably damaging Het
Kif3c C A 12: 3,366,126 A49E probably benign Het
Kifap3 A T 1: 163,795,989 K108N probably damaging Het
Lama3 T A 18: 12,430,000 F527I probably damaging Het
Layn A G 9: 51,077,052 probably benign Het
Lims2 G T 18: 31,957,262 W276L probably damaging Het
Lsp1 T C 7: 142,488,442 L133S probably damaging Het
Map3k6 T G 4: 133,246,900 V536G probably damaging Het
Med7 T A 11: 46,440,854 L92H probably damaging Het
Mllt1 A G 17: 56,927,042 V48A probably damaging Het
Mpp5 G A 12: 78,797,232 R70H probably damaging Het
Neurl4 T A 11: 69,910,262 V1153E probably damaging Het
Nkx2-1 A C 12: 56,534,802 C87G probably damaging Het
Nsun7 T C 5: 66,278,657 S291P probably damaging Het
Olfr148 A T 9: 39,614,494 Q309L probably benign Het
Olfr1508 G A 14: 52,463,488 P174S probably damaging Het
Olfr406 A T 11: 74,269,724 I112F probably damaging Het
Olfr46 A T 7: 140,610,460 N90I possibly damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Pbrm1 A G 14: 31,045,422 Y331C possibly damaging Het
Pirb T A 7: 3,716,274 T539S probably benign Het
Plch2 T G 4: 154,984,228 T1314P probably benign Het
Polk T C 13: 96,508,220 S133G probably benign Het
Prdm5 A T 6: 65,927,983 K533* probably null Het
Prmt1 T A 7: 44,983,573 Q35H probably benign Het
Pum3 A T 19: 27,424,225 W142R probably damaging Het
Rest G A 5: 77,282,608 R958H probably benign Het
Ripor2 G A 13: 24,671,903 G109R probably damaging Het
Sec62 C T 3: 30,818,829 Q354* probably null Het
Snx14 T C 9: 88,381,791 Y847C probably damaging Het
Soga1 T C 2: 157,018,370 R1650G possibly damaging Het
Sox7 A T 14: 63,947,989 D158V probably benign Het
Spag8 A G 4: 43,652,034 V350A possibly damaging Het
Syngr1 A T 15: 80,111,733 I158F probably damaging Het
Tacstd2 C A 6: 67,534,995 V238L probably benign Het
Tex15 T C 8: 33,572,986 S815P possibly damaging Het
Tmem117 A T 15: 94,714,912 T110S possibly damaging Het
Tnrc6a T C 7: 123,171,495 I836T probably benign Het
Trim30b C A 7: 104,357,362 V96L probably benign Het
Tssk3 TGCTATCATGGGG TG 4: 129,489,313 probably null Het
Tyk2 G T 9: 21,120,526 H418N probably benign Het
Uap1 G T 1: 170,158,903 T170K probably damaging Het
Vmn1r40 T C 6: 89,714,624 V141A not run Het
Vmn1r54 T A 6: 90,269,665 I187K probably damaging Het
Vmp1 C T 11: 86,602,033 V317M probably damaging Het
Wnt8b A G 19: 44,512,072 K366R probably benign Het
Zfp207 C T 11: 80,395,178 P415L unknown Het
Zfp263 A G 16: 3,744,571 E66G probably damaging Het
Zfp985 T A 4: 147,583,456 H260Q probably damaging Het
Zmiz1 GCC GC 14: 25,576,200 probably null Het
Zmiz1 A C 14: 25,576,207 Q46P probably damaging Het
Zmiz1 A G 14: 25,576,209 R47G probably damaging Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R6989:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7396:Rictor UTSW 15 6786981 missense not run
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGATTTGTACAGTGGTGATAAGG -3'
(R):5'- CTTCCTTCATTTGGAGACTTAGGC -3'

Sequencing Primer
(F):5'- GCCATTAAGGACTTTTTCTGT -3'
(R):5'- CATTTGGAGACTTAGGCATCTTATG -3'
Posted On2019-06-26