Incidental Mutation 'R7217:Prl8a2'
ID561546
Institutional Source Beutler Lab
Gene Symbol Prl8a2
Ensembl Gene ENSMUSG00000018259
Gene Nameprolactin family 8, subfamily a, member 2
SynonymsDPRP, Dtprp, D/tPRP, mdPRP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7217 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location27345673-27354216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27351015 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 91 (E91G)
Ref Sequence ENSEMBL: ENSMUSP00000018403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018403] [ENSMUST00000110363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018403
AA Change: E91G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018403
Gene: ENSMUSG00000018259
AA Change: E91G

DomainStartEndE-ValueType
Pfam:Hormone_1 16 240 6.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110363
AA Change: E90G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105992
Gene: ENSMUSG00000018259
AA Change: E90G

DomainStartEndE-ValueType
Pfam:Hormone_1 15 239 2.1e-46 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced pregnancy success when exposed to hypoxic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik C A 5: 138,646,926 H358N probably benign Het
Abcg3 A G 5: 104,939,228 F543L possibly damaging Het
Asnsd1 T C 1: 53,348,193 T92A probably damaging Het
Atg2a G T 19: 6,253,441 probably null Het
Aven T A 2: 112,630,846 N327K possibly damaging Het
Brd9 T C 13: 73,938,944 V116A probably damaging Het
Car14 A G 3: 95,899,317 S250P probably damaging Het
Ccdc138 T C 10: 58,509,600 I138T probably benign Het
Cmya5 A G 13: 93,090,430 Y2717H probably damaging Het
Eno1b C A 18: 48,047,679 T308K probably damaging Het
Epha3 T C 16: 63,552,494 T949A probably benign Het
Fcrl5 C T 3: 87,443,774 T197M probably damaging Het
Foxp2 A T 6: 15,416,024 Q664L unknown Het
Fsip2 A T 2: 82,989,068 K5048N possibly damaging Het
Gcnt4 T C 13: 96,946,310 L38P probably damaging Het
Gm11127 A C 17: 36,056,343 M329R probably benign Het
Gpr68 A G 12: 100,878,799 V162A possibly damaging Het
Grin3a A T 4: 49,770,741 M677K possibly damaging Het
Grm7 A G 6: 111,358,824 Y732C probably damaging Het
Hoxb4 A G 11: 96,319,080 E104G probably benign Het
Kat7 A G 11: 95,291,564 S237P possibly damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kif20a T A 18: 34,629,560 H495Q probably benign Het
Lama1 A T 17: 67,764,673 T852S Het
Mep1b T A 18: 21,093,543 D487E probably benign Het
Mki67 T C 7: 135,704,182 T656A probably damaging Het
Mlh3 A G 12: 85,266,707 W902R probably benign Het
Muc16 A T 9: 18,644,076 Y3640* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Pkd1l2 A G 8: 116,995,797 I2424T probably benign Het
Prpf18 A G 2: 4,645,624 V65A probably benign Het
Pxmp2 A G 5: 110,285,905 V34A probably damaging Het
Ranbp2 T G 10: 58,452,017 Y36D probably damaging Het
Rbm25 G A 12: 83,664,217 R368Q unknown Het
Rims2 C A 15: 39,476,489 L860M probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Scn8a A T 15: 100,970,227 M318L probably benign Het
Slc35b2 A G 17: 45,565,029 T55A probably benign Het
Trnp1 T C 4: 133,498,105 E118G possibly damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wdfy3 A T 5: 101,901,919 H1680Q probably damaging Het
Zfp131 A G 13: 119,775,841 I327T probably damaging Het
Zfp729b A G 13: 67,595,248 V66A probably damaging Het
Other mutations in Prl8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02654:Prl8a2 APN 13 27352797 missense possibly damaging 0.56
IGL03268:Prl8a2 APN 13 27353955 missense probably benign 0.09
R0557:Prl8a2 UTSW 13 27352892 nonsense probably null
R0574:Prl8a2 UTSW 13 27348900 missense probably damaging 1.00
R1166:Prl8a2 UTSW 13 27353952 missense possibly damaging 0.53
R1401:Prl8a2 UTSW 13 27353996 missense possibly damaging 0.55
R1875:Prl8a2 UTSW 13 27351054 missense probably benign 0.02
R2420:Prl8a2 UTSW 13 27348913 missense possibly damaging 0.46
R4152:Prl8a2 UTSW 13 27351002 missense possibly damaging 0.86
R5285:Prl8a2 UTSW 13 27350133 unclassified probably null
R6452:Prl8a2 UTSW 13 27352797 missense probably benign 0.08
R6906:Prl8a2 UTSW 13 27348917 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTTGATAAATTCACTCCCTTCAGTG -3'
(R):5'- ATGCCTGCCCTAACTGACAG -3'

Sequencing Primer
(F):5'- CAGAATTGGGTAATTGGCACTTTC -3'
(R):5'- GCAGCACACACTCAGGG -3'
Posted On2019-06-26