Incidental Mutation 'R7218:Ano7'
ID561564
Institutional Source Beutler Lab
Gene Symbol Ano7
Ensembl Gene ENSMUSG00000034107
Gene Nameanoctamin 7
SynonymsTmem16g, NGEP-L, IPCA-5, NGEP, Pcanap5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7218 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93373930-93404303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93380469 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 74 (D74G)
Ref Sequence ENSEMBL: ENSMUSP00000050495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058682] [ENSMUST00000186641]
Predicted Effect probably benign
Transcript: ENSMUST00000058682
AA Change: D74G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000050495
Gene: ENSMUSG00000034107
AA Change: D74G

DomainStartEndE-ValueType
Pfam:Anoct_dimer 49 274 2.2e-63 PFAM
Pfam:Anoctamin 277 824 3.4e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186641
AA Change: D74G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140438
Gene: ENSMUSG00000034107
AA Change: D74G

DomainStartEndE-ValueType
Pfam:Anoctamin 277 825 6.6e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. In humans, this protein is primarily found in prostate tissues and may serve as a target for prostate cancer immunotherapy. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Ano7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ano7 APN 1 93402166 missense probably benign 0.04
IGL00838:Ano7 APN 1 93402757 missense possibly damaging 0.91
IGL01295:Ano7 APN 1 93380478 missense probably benign 0.00
IGL01322:Ano7 APN 1 93395508 missense probably benign 0.08
IGL01807:Ano7 APN 1 93402696 missense possibly damaging 0.66
IGL01859:Ano7 APN 1 93394446 missense probably damaging 1.00
IGL02349:Ano7 APN 1 93391490 missense probably benign 0.02
IGL02976:Ano7 APN 1 93402673 missense possibly damaging 0.78
R0360:Ano7 UTSW 1 93388658 missense probably benign 0.01
R0364:Ano7 UTSW 1 93388658 missense probably benign 0.01
R0528:Ano7 UTSW 1 93395502 missense probably null 1.00
R0741:Ano7 UTSW 1 93401587 missense probably damaging 0.97
R1131:Ano7 UTSW 1 93401776 missense probably benign 0.24
R1156:Ano7 UTSW 1 93401852 unclassified probably null
R1500:Ano7 UTSW 1 93397328 missense probably damaging 1.00
R1710:Ano7 UTSW 1 93385624 missense probably benign 0.00
R2002:Ano7 UTSW 1 93400581 unclassified probably benign
R2062:Ano7 UTSW 1 93390313 missense probably benign
R2120:Ano7 UTSW 1 93402133 splice site probably benign
R2200:Ano7 UTSW 1 93380436 missense possibly damaging 0.93
R2268:Ano7 UTSW 1 93380439 missense possibly damaging 0.51
R2763:Ano7 UTSW 1 93399186 splice site probably null
R4202:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4204:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4205:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4453:Ano7 UTSW 1 93394353 missense probably damaging 1.00
R4627:Ano7 UTSW 1 93375185 missense probably benign 0.15
R4735:Ano7 UTSW 1 93400494 missense probably benign
R4809:Ano7 UTSW 1 93394566 missense probably benign 0.20
R4935:Ano7 UTSW 1 93395314 missense possibly damaging 0.48
R4970:Ano7 UTSW 1 93397363 missense possibly damaging 0.77
R5112:Ano7 UTSW 1 93397363 missense possibly damaging 0.77
R5249:Ano7 UTSW 1 93375196 missense probably benign
R5813:Ano7 UTSW 1 93384919 critical splice donor site probably null
R6181:Ano7 UTSW 1 93395359 missense probably damaging 1.00
R7106:Ano7 UTSW 1 93374983 intron probably null
R7113:Ano7 UTSW 1 93385620 missense probably benign 0.10
R7199:Ano7 UTSW 1 93402978 missense
R7381:Ano7 UTSW 1 93395335 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAACCCATGGCTCTCACTTC -3'
(R):5'- GTGCTTCATATCCTTGGGCAG -3'

Sequencing Primer
(F):5'- GCATCCCTGCTGAGACCAC -3'
(R):5'- TCATATCCTTGGGCAGTAAGC -3'
Posted On2019-06-26